More Ties Between Viruses And Monkeys
Joe Gandelman
Another new virus is attributed to monkeys:
WASHINGTON - Two new retroviruses never before seen in humans have turned up among people who regularly hunt monkeys in Cameroon, researchers reported on Friday.
Like the AIDS virus, these viruses insert their genetic material directly into cells and perhaps even into a person's or animal's chromosomes. Closely related versions of the viruses cause leukemia, inflammatory and neurological diseases.
The two new viruses are called human T-lymphotropic virus types 3 and 4 or HTLV-3 and HTLV-4. They are closely related to two known viruses called HTLV-1 and HTLV-2, which experts believe were transmitted to people, like HIV, from monkeys and apes.
This is news because of constant research going on about the origin of AIDS:
"Because HIV originated as a cross-species infection from a non-human primate virus, the question was how much cross-species retrovirus infections are occurring and what are the consequences of these infections," said Walid Hemeine of the U.S. Centers for Disease Control and Prevention, who led the study.
They examined blood samples from 930 Cameroonians who had handled or eaten bush meat — monkeys or apes hunted for food.
They used antibody screening and genetic analysis to find at least six different simian retroviruses had infected 13 of the people.
"Two hunters were infected with two previously unknown HTLV viruses. One person was infected with HTLV-3, which is genetically similar to a simian virus, STLV-3, and represents the first documented human infection with this virus," the researchers told the 12th Annual Retrovirus Conference being held in Boston.
"The second hunter was infected with HTLV-4, a virus distinct from all previously known human or simian T-lymphotropic viruses."
So what happens next?
"It's totally new so we don't know any other simian virus that is related to it," Hemeine said in a telephone interview.Now the team, which includes researchers at Johns Hopkins University in Baltimore, plans to look more extensively in Central Africa for the virus, Hemeine said. "They could be more widespread than we think they are," he said.









Oh my perhaps I'll get a porcine retro-virus from the ham sandwich I had for lunch.
It might kill me in 50 years or so.
Then again it might not.
There is a reason why there is a lot of concern regarding the bird flu, with dead people in Asia to back that concern up. Biological systems are very complex, and it is difficult to directly link things together because so many different effects arise from unknown, uncontrolled factors.
And, (writing this from memory, I have to go to work soon so I'll look up the details later) in the early days of medicine a researcher proposed that disease was from small organisms that could be isolated, not from "bad air". Another man "proved" him wrong by drinking water that had been contaminated with a disease organism the first man claimed to have isolated. The man who drank the contaminated water did not get ill, thereby "proving" the first man wrong, but he had been exposed to the disease in his childhood and had immunity.
If we had followed that conclusion, that diseases are not usually caused by micro-organisms, then we would not be as healthy as we are today.
It's easy to throw rocks. It's not so much fun when your grandfather is dying of cancer and your grandmother has emphysema, both of which seemed to be linked to the smoking they did for 40 years, but of course, we cannot definitively link smoking to those two illnesses either.
Show me your data for where the viruses mentioned in the post DID come from, and we can discuss it.
By the way, the first noted cases of AIDS at the time (very early 1980s) in the US were among Hatian immigrants, not "a cluster of very sick gay men in SF". Readers Digest had an article on it, I can't remember what magazine they had condensed the article from. One of the worlds largest flu epidemic started as a virus in pigs. Is that species jump any more believable, or are the researchers wrong about that one, too?
Your questions have all been answered, multiple times and in detail. I've simply had enough of spoon-feeding people like you who don't do your homework but feel like you know everything already.
HIV doesn't do what it's billed to do, Jack. It just doesn't. Even Montagnier himself doesn't believe it anymore. You want a starting point? CLICK HERE AND READ THIS, then get back to me if you want more references. Straw man arguments and references to the Reader's Digest just don't cut it with me anymore.
Nobody denies that diseases are caused by micro-organisms. But the majority of micro-organisms are completely harmless to us.
In fact there are more individual micro-organisms on your skin than there are people in the world. Some micro-organisms are symbiotic with us, like the bacteria in your gut which help with digestion. Others help keep your mouth and other damp places clean, which is why people on antibiotics often get thrush, the good helpful bacteria which help keep yeast at bay are killed and the yeast (thrush) proliferate.
How viruses fit the picture nobody knows but again they are for the most part harmless.
An interesting hypothesis about disease organisms is that they evolve to become less harmful to their hosts over time and eventually might become fully symbiotic. The reasoning behind this theory is that harming your host is not the optimum survival strategy and the heathier your host the longer you live and the more chances you get to propagate to new hosts.
enough already, we scoff because of the pessismistic assumptions about any new organism being the new apocalyptic disease which bring civilization to its knees.
There was a cluster of Karposi's Sacoma patients diagnosed in New York in March 1981. This was clearly something new. Karposi's Sarcoma is an old disease that was known in three forms at that time but these cases presented differently. This new form of Karposi's Sarcoma today is known as Epidemic Karposi's Sarcoma to differentiate it from the earlier variants (classic, endemic (or AFRICAN) and iatronic.)
In June it was noticed that there had been a cluster of Pneumocystis carinii pneumonia (PCP) paients diagnosed in California. It was realized that a similar cluster had occurred in New York some of whom also had Karposi's Sarcoma. All of the Karposi's Sarcoma and PCP patients were GAY MALES. Welcome to the beginning of the AIDS SCARE.
IT was a year later that some 34 cases of 'AIDS' were detected in Florida amongst Haitians. But by this time everyone was actively looking for AIDS patients and everyone who had PCP, Karposi's Sarcoma or unexplained Immuno suppression was almost automatically scooped up into AIDS victim pool.
I must try and find out what afflicted these Haitians Karposi's Sarcoma or PCP or both?
Could be interesting especially if Haitians are subject to endemic (or AFRICAN) Karposi's Sarcoma. SO many questions so few answers.
It's not just a questionable idea. It's an incredibly silly idea.
Mind you, it's an unbelievably stupid blunder that has cost countless lives. It's a comedy of errors on an epic scale. It really is.
Why does anyone believe this silly idea anymore?
I mean the absurdity just struck me driving home today: they're trying to tell us that a disease which can't cross-infect with chimps--chimps, which get sick with every other known human virus, this one little virus can't--while at the same time trying to tell us that HIV somehow got into the human population because some human in Africa had sex with a monkey (a monkey who wasn't a chimp)--- and that there are two separate strains of this virus, one that only infects black people in Africa and another than only infects Americans and Europeans....
Silly. It's silly. Why does anyone believe this horseshit anymore?
To follow up on my posts to you in the next most recent HIV thread, this is what I don't get. You've said you don't believe in a conspiracy. However, given there are literally thousands of highly trained biologists and doctors working on HIV and AIDS who don't seem to agree with your suggestion that it's simply silly to believe HIV causes AIDS, something has to explain all those PhD/MDs who are confused about this. What do you think is going on with them?
Are they:
a) Purely selfishly opportunistic - they all know HIV doesn't cause AIDS, but there's a living in it.
b) Ignorant - they've never once encountered the suggestion that HIV doesn't cause AIDS, so it's never crossed their minds to question the prevailing paradigm.
c) Stupid - they truly believe that HIV causes AIDs but it's because they're not bright enough to comprehend the arguments which convinced you.
d) ??
I know you've mentioned other cases where the medical establishment has been wrong. I'm not aware, though, that any of them survived the presentation of serious counter-evidence from within the medical community (that's why we know about them today). I also don't believe any of those cases involved the sheer mass of brainpower currently being directed at HIV/AIDS. Why is it different this time?
Nobody denies that diseases are caused by micro-organisms. But the majority of micro-organisms are completely harmless to us.
God Bless you! A refreshing burst of common sense.
The human body is a biological machine that lasts 80 years.
Every single day of its life it is assaulted by millions of micro-organisms. Most are so obscure and impotent, that we don't feel them, or even bother to name or catalogue them.
Indeed, they are easily dispatched by the body's immune system. Every single day of your life. That's why we are able to live, mostly in good health!
Lemme try an analogy:
1. 1 nucleotide = 1 letter in the alphabet.
2. English Alphabet = 26 letters (A,B,C...Z)
3. Genetic Alphabet = 4 letters (A,C,G,T)
4. Gene = Word
5. Chromosome = Book
6. 46 Chromosomes (human)= Entire Encyclopedia Set.
To compare, HIV has only 9000 nucleotides (base pairs) of genetic information.:
ACGTCTAGC
The human cell has a whopping 3 million nucleotides:
ACGCGTATGCGTAGCAAAACGTGAGTGCATTGCA
Think it through, people: Genetically, the virus is as sophisticated as the word "the", while the cell is as sophisticted as the entire Encyclopedia Brittanica.
So, this bizarre quest by the virus hunters to blame any new ailment on some obscure virus (a monkey virus! a mosquito virus! a gerbil virus) is very foolish, particularly in the modern era of healthy diets and excellent sanitation.
The top 3 killers in America are:
1. Heart Attacks
2. Cancer
3. Stroke
This accounts for about 60 - 70% of all deaths.
These virus hunters are kinda like the scientific equivalent of the professional "civil rights" activists. They did a wonderful job in the 60's. They are genuine heroes. The nation owes them a debt of gratitude. Thankfully, they won!
And, now, they should disband and go home.
Hank Barnes
So Polio at 7500 BP or so...is harmless simply b/c of it's size?
Hell, a simple base pair mutation can cause Sickle Cell anemia. Glu to Val on the beta chain of hemoglobin. How's that for a small killer?
The size argument has no merit Hank--you've had better arguments than that one.
Sorry, 5 rhetorical questions ain't an argument.
Such a virus cannot overtake and kill White Blood Cells -- nature's cytotoxic cells designed to kill antigens.
If you were arguing that HIV killed, say, skin cells, you'd have a point.
But, your argument is that a "new" super-duper virus discovered in 1981, can somehow kill white blood cells (and no other cells), which is ass-backwards to say the least.
Like saying we have a new running back that's so good, every time he is tackled, he injures the linebacker.
Sorry, No, the tacklers are most often the ones that cause the damage, not the tacklees.
Is it theoretically plausible? Perhaps, but then we would find such virus quite easily and abundantly. Wouldn't need surrogate markers (anti-bodies or PCR) to detect, it would be all over the place, replicating and causing injuries immediately -- not after a 10-year latency period.
Follow closely, grasshopper!
Hank Barnes
To compare, HIV has only 9000 nucleotides (base pairs) of genetic information.:
ACGTCTAGC
The human cell has a whopping 3 million nucleotides:
ACGCGTATGCGTAGCAAAACGTGAGTGCATTGCA
Think it through, people: Genetically, the virus is as sophisticated as the word "the", while the cell is as sophisticted as the entire Encyclopedia Brittanica.
Your argument was that a virus so small could cause no damage. In your first comment that is what you were implying. Small virus can't cause damage. Did I misread? I don't think I did.
So forget the rhetorical questions. A small genetic mutation can cause sickle cell anemia. Another small virus can cause polio. Size is irrelevant in those cases. Nature can pack one helluva a punch in a very small package.
If you want to rephrase your argument to ones you've used before then that is fine...but this new anaglogy proclaiming a virus cannot cause damage simply b/c of its size is off the wall. Like I said...you've done better.
If you think a pathogen should have a big genome then you had better watch out for your sandwich! Wheat has a genome size over 4 times that of a human being (which by the way is a wopping 3,000 million not 3 million nucleotides).
Dale
Small virus can't cause damage. Did I misread?
Yes, you did. "Small virus" is redundant. All viruses are small. Only in large numbers, by killing large numbers of cells, can they cause disease.
The issue is how/why this undistinguished virus -- yes, same size genome as polio virus -- can do something no other virus has been shown to do -- namely, be harmless to all cells, yet pathogenic to a subset of White T-Cells.
As you know, polio (which you keep mentioning) was cured by vaccine -- ie, natural antibodies stimulated by weakened strains of the virus.
So, the presence of antibodies to polio is a good thing.
Yet, the presence of antibodies to HIV is considered a bad thing, ie future disease.
The more I talk to AIDS fanatics, the more I realize they have most things backwards.
Dale:
If you think a pathogen should have a big genome [No, I don't]
..then you had better watch out for your sandwich! Wheat has a genome size over 4 times that of a human being
[Yes, that is remarkable, but true!]
(which by the way is a wopping 3,000 million not 3 million nucleotides).
Million for Billion, my bad.
But, like JP, you are missing the point like a mack truck -- it isn't the number of nucleotides per se -- it's what an organism can do with the nucleotides (ie, how genes are expressed).
But you're straying into genetics, where we probably agree on the most things.
The issue with HIV, though, is that it is supposed to be a super-duper virus that is harmless in monkeys, harmless in a petri dish, harmless to all cells, except, bizarrely the subset of white blood cells (T-Cells) that are most efficacious at killing viruses, but only in amounts that are virtually undetectable.
It's like horrible, murderous schoolyard gang, that doesn't harm any kids, but can magically kill math teachers (and only math teachers) with one punch.
It don't add up.
Barnes
If it's not the size of the genome per se...then why did you present your argument as such? And you did. I didn't misread. And I'm not a fanatic. Nor am I a grasshopper.
Perhaps we missed your mack truck point b/c you were driving down a side street while we were standing on the main road?
It's like horrible, murderous schoolyard gang, that doesn't harm any kids, but can magically kill math teachers (and only math teachers) with one punch.
It don't add up.
The problem with that argument Hank is that unless you believe the universe was created by 'intelligent design', there is no reason why a particular plant or animal or virus or unicellular organism should 'make sense'. There are valid scientific reasons why HIV preferentially infects T cells; those being the cells that are most likely to express the proteins that HIV uses to enter the cell. Many viruses show preferential affinity for one cell type over another.
Dale
Well, you're being unusually reasonable today:)
There are valid scientific reasons why HIV preferentially infects T cells; those being the cells that are most likely to express the proteins that HIV uses to enter the cell.
See, this sounds good. No doubt about that.
But, I'm staring (blankly, I might add) at Nature Medicine, 2 articles by Gorochov and Pakker (1998). Frankly, they are so complicated that I'm having trouble digesting them.
But, there's an editorial in the same issue by Roederer from Stanford which states:
In this issue of Nature Medicine, reports by Pakker et al and Gorochov et al provide the final nails in the coffin for models of T cell dynamics in which a major reason for changes in T cell numbers is the death of HIV-infected cells.
Then he ends with this:
Finally, the facts (1) that HIV uses CD4 (T-Cell) as it primary receptor and (2) that CD4(T-Cell) numbers decline during AIDS, are only an unfortunate coincidence that have led us astray from understanding the immunopathogenesis of this disease.
And, I'm saying to myself: Is he suggesting that HIV kills T-Cells, but not by infecting them?????
How on earth can this be possible, Dale?
Hank
Read a little further Hank and it will all become clear.
Just look at 2/3rds of the arguments of HIV's defneders that have ever appeared here on Dean's World--and when I say 2/3rds, I think I'm being generous. "That doesn't prove HIV doesn't cause AIDS!" "That doesn't prove HIV doesn't cause AIDS!" "Well yeah that may be true but HIV may still cause AIDS because..."
In other words, lots of challenges to prove a negative.
Tell me, should it be that hard to argue a virus hypothesis? Should those who doubt it have to prove a negative to be taken seriously?
No one with any brains disputes that the Chicken Pox virus causes chicken pox. No one with any brains disputes that the polio virus causes polio. If you've watched this debate unfold over the last six weeks or so here on Dean's World, it's been most remarkable: we've had molecular biologists, PhD mathematicians, practicing researchers, people with HIV+ individuals in their families come in on this, and not a single one of them has ever suggested anything hippy-dippy crazy: "Disease is caused by negative vibbes from the cosmos man!" or "if only you take these vitamins you'll be 100% healthy" or "just take chelation therapy and these special colloidal minerals and chant this chant here and you'll be all good!" bullshit. Nor anyone--not a single person!--saying "this is God's wrath on the disgusting homos and druggies."
None of it!
So ask yourself this: why have we had endless discussion on the MOTIVATIONS of those who question the theory?
I mean, you're asking me to speculate on the motivations of those who DEFEND the theory, but all your questions to me, and the questions of most others, have been along similar lines: "What are you GETTING AT, Dean? What do you REALLY INTEND with your questioning of this? What are you REALLY SAYING?"
What we're REALLY SAYING is that this theory is a crock of shit.
How do crock-of-shit theories come to be accepted by wide swaths of wise and learned heads? Ask that about any flawed theory of history. Ask it about the physicists who believed in the mystical medium called "the ether" which light and radio waves supposedly travelled through. Ask it of those who believed that Pellagra was caused by bacteria. Ask it of those who believed that bipolar disorder was caused by a wandering uterus. Ask it of those who treated syphilus with arsenic--or who thought you couldn't treat ulcers with antibiotics.
My counter-question for you: what makes you think that today's researchers are wiser and smarter and more pure and altruistic than any of the researchers of history?
Elizabeth: The HIV/AIDS theory is a theory wrought with paradoxes. One paradox alone is enough to cause a theory to be brought into question. HIV/AIDS has dozens, and those who defend it, rather than having a single obvious answers content themselves to run around patching up holes and attacking the character of those who call bullshit.
I call bullshit. Many working MDs, microbiologists, molecular biologists, mathematicians, and people living with HIV call it into question. Some who question it are nuts, but so what? Some who questioned whether the sun revolved around the Earth had their own idiot theories that were also false.
Ask yourself why you believe this bullshit, and if you have any reasons other than "all these wise learned heads couldn't be wrong, could they?"
Tell me, do YOU believe that a virus entered the human bloodstream because someone had sex with a monkey 30 years ago in Africa, and that this has somehow resulted in two completely different strains of the virus, one of which ONLY infects black Africans and never makes its way to Americans and Europeans, while another one only afflicts Americans, Canadians, and Europeans? Does that even fucking make sense?
This is why I believe Oswald acted alone. It requires too many conspirators acting in concert, and then keeping their mouths shut, to take most of the other theories seriously.
This is why I believe aliens in flying saucers have never visited the Earth in my lifetime (or probably ever). The business with government researchers and Air Force guys at Roswell all conspiring to hide the truth for decades: simply implausible.
Crack was invented by the CIA to kill black people? Bullshit.
But believing that the HIV/AIDS theory is wrong? Hellfire people, Luc Montagnier has maintained from day one, and still maintains to this day, that HIV alone probably does not cause AIDS.
Kary Mullis said it very well: if you get out of college and get a job with IBM, you do not walk up to the CEO of IBM and say, "do our machines do what we say they do? Are our products any good?" Of course not. You see a reasonable hypothesis ("our products work and do what we say they do") and you go to work from there.
Believing HIV doesn't cause AIDS only requires a few basic assumptions:
1) Everyone in the early days was desparately looking for an answer.
2) One or two researchers managed to convince some political people that they were correct.
3) Due to a confluence of political forces, it was easy to make anyone who questioned it look like homophobes.
4) The system began to feed on itself after that, with bureaucracies in government and corporate America who all had a self-interest in maintaining and not questioning the status quo.
No conspiracies here. And in only a very few cases, no requiremenet for bad faith at all.
Let me ask you to play this as an intellectual exercise: Try spending the entire next week looking at HIV literature, and assume that the theory is simply wrong. Not that 99.9% of those who believe it are evil or have any bad motives. They're just... wrong.
How does most of the news coverage start to look to you? How does 98% of what you see in Medline onthe subject start to look to you?
You know, only ten years ago they were all still telling us that low-fat diets prevent heart disease. But they don't. Was there a conspiracy there?
Nah, I think someone cut himself while skinning a chimp.
"and that this has somehow resulted in two completely different strains of the virus, one of which ONLY infects black Africans and never makes its way to Americans and Europeans, while another one only afflicts Americans, Canadians, and Europeans? Does that even fucking make sense?"
There are several strains of HIV which are dispersed around the world mainly according to geography (now there's a shocker!). Naturally, the strain predominant in North America and Europe is the one which kills African-Americans.
And yet what we recognize as polio (i.e. the paralysis) only afflicts something like 5% of people infected with the virus ... far fewer than the proportion of people affected by HIV.
Like I said to Hank, HIV may not behave the way you think a virus should behave but it's not the only thing in nauture with that annoying property.
Dale
No, for the second time, you missed it.
The argument is not:
1. Virus has small unimpressive genome
2. Therefore, it cannot cause disease.
The argument is:
1. Virus has small unimpressive genome
2. This genome is indistinct from numerous other viruses.
3. These viruses infect and lyse cells (skin, nerve, intestinal)
4. These viruses ARE SYSTEMATICALLY killed by white blood cells.
5. Therefore, it's screwy that HIV is harmless to these (skin, nerve, intestinal, etc.) cells, yet harmful to a subset of the most POWERFUL white blood cells.
That would be a super-duper virus.
But, then it wouldn't have a 10-year latency period, and it wouldn't be found in only 1 in 500 t-cells.
You're the one responding to me, not vice-versa. So, if you don't like my posts, simply don't respond.
But misrepresenting my argument is a bogus tactic.
Hank Barnes
If HIV's cell selectivity doesn't make sense to you that may be because you don't understand it. There is nothing supernatural or unreasonable about it. It's like gaining entry to a locked room. The important thing isn't how sophisticated or simple either the lock or the key are; the important thing is that they fit together. A virus can't replicate until it can get inside a cell. That can't happen until the virus makes it past the cell membrane which forms the surface barrier of the cell. You can think of the proteins and other molecules that are present on the surface of the cell as being locks that prevent entry to the cell. Different kinds of cells have different sets of locks. But as long as the virus has a key for at least one of those locks, it can get inside the cell. HIV makes two proteins called gp120 and gp41 (which require less than 3000 of its ~9000 nucleotides to make, by the way). These proteins are unique to HIV and they form a key that recognizes a lock consisting of two proteins called CD4 and a coreceptor protein. CD4 and the coreceptors happen to be expressed primarily on the surface of a subset of white blood cells and not on skin or intestine or nerve cells. Skin and nerve and intestine have their own proteins that are unique to them and not expressed on white blood cells but since HIV only has that one key it can only get into those cells that have the appropriate lock.
Dale
That's all easy and basic.
You are being myopic to the Nth degree -- unable to grasp the huge distinction between killing normal cells and killing white blood cells.
Hank Barnes
Obviously neither easy nor basic if you still don't get what I'm trying to tell you. There are no "normal cells". The T cells that are particularly susceptible to HIV are neither more nor less unique than any other cell type.
Dale