Dean's World

Defending the liberal tradition in history, science, and philosophy.

References, But First Some Personal Statements

Almost two weeks ago I published Dr. Harvey Bialy's piece, "Falsifying the HIV/AIDS Hypothesis." That single piece generated more controversy than any piece ever has on Dean's World. In fact, the discussion thread is still going, with 589 comments at this writing. There are so many people with PhDs in that discussion it looks like we could staff a small university. It has been at turns enlightening, amusing, and maddeningly frustrating to read--but believe it or not, a big chunk of those messages are worth reading.

One major thing that came out of the discussion was that one of the graphs was mislabled. That's my fault. The second graph, showing a strangely steady rate of HIV in the population over 20 years should not have been labeled "incidence" but rather "prevalence." The error was mine. That said, those suggesting that such a comparison is "apples and oranges" are mistaken. If the numbers are correct, then comparing that to the incidence of AIDS cases is entirely appropriate.

Some disputed the numbers. Some did so politely, some sneeringly. Despite the sneers, I went ahead and contacted Duesberg and Rasnick for sources, and within short order Rasnick (who compiled the figures originally for the paper) came up with a long list. I've been sitting on that list for over a week.

Why? I'll tell you why: Because every time I think about wading back into that discussion, I get a searing headache and think, "I'd rather drive an icepick into my eyeball."

I'm tired--very, very, very tired--of people being nasty. So: I'm posting these references. But the very first person who acts snotty, condescending, or sneering (whether in support of the HIV skeptics or in refuting them) will get tossed permanently off of Dean's World. I don't care who started it, at this point we reset to zero. No matter whose side you're on, there's one rule:

You get nasty, you get gone.

Furthermore, make so much as one--just one--snide insinuation about my character, and you're gone. I did not create this blog so people could use me as a punching bag.

You got questions? Think first about whether the answer is self-evident. If it's not self-evident, phrase it in such a way as to assume that the other side is acting in good faith.

Also by the way, pelting your host with dozens of questions at once is a good way to get ignored. Most of you are perfectly capable of writing to Duesberg yourself--the man's web site and email address are publicly available. I have invariably found that whenever I write him with a reasonable question, he comes back within a day or four with perfectly civil and clear responses.

If you're too timid to ask him yourself, or think your question is so important it needs a public airing, you can address it to me and I'll forward it--but make it specific, non-snotty, non-sneering, non-condescending, and to the point. I've had it up to here with offering this only to have some jerk rattle off a long list of "questions" that are just veiled editorials, or which are clearly answered in the free literature that's available if you just click here.

Also, if you don't like that I'm talking about this stuff, you have a simple recourse: GO AWAY. PROBLEM SOLVED!

I've also had my motives questioned. Seriously now: enough of that. I'll make one further statement on my motives, and that will be that:

I've been reading about HIV and AIDS on and off for about 20 years, and have had friends in the community most affected (the gay community) for even longer. As I noted in HIV Skepticism, I've also been watching the HIV skeptics since the early 1990s. Obviously there are some lunatics among them, but there are some who don't seem like lunatics at all. Wrong? Perhaps. Lunatics? No.

In the meantime, I have watched the medical establishment over the last 20 or so years go from telling people that a) an HIV+ diagnosis meant death within a year, b) to slowly and grudgingly admitting that maybe HIV had a latency period in some people, c) to saying that yes there's a latency period of up to five or ten years, d) to now saying there's an average latency of ten years. Now this last year or so they've begun e) grudgingly admitting that some people, through mechanisms poorly understood but probably genetic, may be completely immune!

Serious question for the audience: why were gay men, most of them in their teens and 20s, dropping like flies in the early 1980s from an infectious disease with an average latency period of ten years?

Anyway: I've also watched to my astonishment as doctors admitted that practically all the treatment protocols of the 1980s and 1990s were overaggressive and at times "counterproductive."

I've also been watching stories for ten years now of parents having their children ripped away by Child Protective Services for refusing to give them AZT--and just yesterday I had a surprise conversation with an attorney who represented one of those parents and is now suing AZT's manufacturer. He told me his case is not unique, and there may be many, many more in the near future. He said that for the most part doctors aren't to blame, but public health officials and pharmaceutical companies have a lot to answer for.

That same day, I got a call from a woman who's been HIV+ for about two decades now, and has refused in all that time to take ANY medications for it. Her name is Christine Maggiore, and she's written a book on the subject (I've mentioned it before). Her husband's made a documentary about her and others like her (which I've also mentioned). She and her perfectly healthy, never-medicated school-aged children were still alive and well as of January 25, 2005. I was flattered to hear from her.

Pretty amazing that a woman who should just happen to decide she didn't believe HIV caused AIDS, and just happened to write a book about it, also by pure chance happens to be one of those rare people who have unusually long latencies or is maybe one of those immune people, isn't it? Well stranger things have happened.

Still, ever since I posted on this people with HIV horror stories have been coming out of the woodwork wanting to talk to me. Are they all wrong? Maybe. But let me tell you, I've got plenty of reasons for my skepticism. So, the next person who pats me on the head, or tells me I need to get a tinfoil hat, not only gets tossed off of Dean's World but also gets a knuckle sandwich if we should ever meet--indeed, book an appointment and I'll deliver it to your doorstep. Be sure to make an appointment with your dentist for shortly afterward. If you're female, I'll have my wife make the delivery. (Warning: she hits harder than I do.)

Anyway, as to Duesberg et. al.'s references: they note that they've been watching the literature on this since the 1980s and pulled all the references together for their 2003 paper. They were never challenged on it by their peers who examined the paper, so they had to recompile them to answer Dean's World readers' challenge. It's been two years, after all.

They recompiled it solely at the request of Dean's World readers--got that? Let it sink in for a minute. This was published in a perfectly respectable peer-reviewed journal. It was reviewed by any number of qualified scientists before publication, and open for comment by scientists afterward, and no one to date has directly challenged these numbers except Dean's World readers. I leave it to you to decide the significance of that.

For whatever it's worth, I told them that if they would provide a half-dozen or so references reasonably spread out over the last 20 years that should be sufficient. I also said that popular press accounts that quote CDC officials would be good too. I brought that up because I've noticed that it seems like every few years the popular press tells us that we're up to almost a million people with HIV.

So: where does the "roughly one million people with HIV in the United States" figure come from? Check the following:

Prevalence of HIV in U.S. Population

Estimates of HIV infections in USA

2004: 950,000

http://www.niaid.nih.gov/factsheets/aidsstat.htm

Columbia Chronicle: Government health agencies report up to 950,000 HIV cases in US

http://www.ccchronicle.com/back_new/2004_fall/2004-11-22/citybeat.php? id=333

2000 and 2003: 950,000

http://www.avert.org/statsum.htm

http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5347a3.htm

2001: 950,000

http://www.wrapp.net/art-not-being-treated.html

1 million:

http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5021a5.htm

1996: 950,000

http://hab.hrsa.gov/reports/rp14.htm

1991: 1 million

http://www.cdc.gov/mmwr/preview/mmwrhtml/00001880.htm

Prior to 1990: one million

http://www.consumeralert.org/fumento/hiv-pill.htm

1990: 1 million http://www.cdc.gov/mmwr/preview/mmwrhtml/00001846.htm

1989: 1 million to 1.5 million

http://www.cdc.gov/mmwr/preview/mmwrhtml/00001477.htm

1988: 1 million to 1.5 million

http://www.cdc.gov/mmwr/preview/mmwrhtml/00001274.htm

1987: 1 million to 1.5 million Human immunodeficiency virus infection in the United States: a review of current knowledge. MMWR 1987; 36 (Suppl 6) 1-48

http://www.cdc.gov/mmwr/preview/mmwrhtml/00014715.htm

1 million to 1.5 million Dondero T. Human immunodeficiency virus infection in the United States: A review of current knowledge. MMWR 1987;36:125-174.

http://hivinsite.ucsf.edu/InSite?page=kb-07&doc=kb-07-04-01-01

Curran, J. W., Morgan, M. W., Hardy, A. M., Jaffe, H. W., Darrow, W. W. and Dowdle, W. R. (1985) The epidemiology of AIDS: current status and future prospects. Science 229, 1352-1357

Also, in case any of those links go bad or expire, here are a few documents I'll host directly here on Dean's World.

NIAD 2004 Report: 950,000 HIV+ in U.S.

New York times: Up to 1 million HIV+ in 2002

American Journal of Public Health: 800-900,000 HIV+ in 1998

CDC Report from 1987: 1 to 1.5 million.

Quite honestly, you don't even need more than the first and last, do you? I just like reading the press reports, since when I searched the web I was able to find them going all the way back to the 1980s with the same numbers.

Note to those who wish to refute: no apples-and-oranges comparisons allowed. That means figures for so-called "HIV/AIDS" get tossed--what's at question is how many people are running around with HIV, period.

Indeed, just ask yourself why some feel compelled to say "HIV/AIDS" when medical authorities now admit that there are countless people walking around with HIV who have no AIDS symptoms whatsoever? And now admit that some people who test HIV+ may well never get AIDS?

Also, since these are CDC projections based on standard methodologies for measuring infectious diseases in the overall population, you don't get to say, "well in this year doctors reported exactly this many cases." Nuh-uh. CDC pulls these estimates from the blood banks, from military recruits, hospital and doctor's reports, and every other possible source to get a look at the overall population, not a hard head count of doctor diagnoses. By all accounts--by all accounts--there are tons of people out there testing HIV+ who simply are not telling their doctors and/or aren't seeking treatment. How many are dying and undiagnosed with AIDS, or walking around healthy, no one can tell you. Not that I've seen, anyway.

Finally, a personal observation: just this last week I heard it announced that researchers believe that within ten years they will have a vaccine to prevent AIDS. I found the timing of that interesting. I also remember the first time I heard that researchers hoped to have a vaccine for preventing AIDS "within 10 years:"

Back in the late 1980s.

I've heard that every few years ever since. "Within 10 years."

And no, I am not being snotty. That's the simple truth.

Anyway, that's the last I've got to say for now. I probably won't even be participating in the comments to this article, but I will be monitoring for people acting like jerks, and watching for any sincere and intelligent questions. I do appreciate the many who have tried to add to public knowledge and awareness on this issue, no matter what side they come down on. Obviously I've made my sympathies known. But I don't claim to know everything, and fully admit that I may be wrong.

(My offer to publish unedited rebuttals to Bialy's piece from qualified researchers or public health officials still stands, by the way.)

Posted by Dean | Permalink | Technorati Trackbacks
Dean Esmay (www):
(By the way, while I said I'd probably try to stay out of the fray here, if I can't resist and wind up commenting, and you see me breaking my own rules, call me on it. I'll have to arrange a suitable punishment for myself if I do.)
1.26.2005 5:48am
Samba Diallo (mail):
Dean

If find it GREAT that this will continue with such a clear (and to me, fair) set of rules. I have a few questions, which are not meant to complicate things at all, au contraire, and are asked in absolute good faith:

1) Is HIV testing (antibody and/or virus components), principles, applications, interpretation of results, and perceived problems, valid topics to discuss? After all, HIV in the population is defined in terms of one or another "test" for HIV or antibodies to it.

2) Is HIV in Africa a valid theme in this discussion? I ask because today much of the HIV-AIDS problem is focused there, and thus the relevance of 1) above.

We all agree that "the test" is one of the most feared rituals in the world, besides its relevance to HIV estimations in the population.

Samba
1.26.2005 6:33am
Dean Esmay (www):
It would seem to me, honestly, that if we are going to get into arguments over the accuracy of tests, we wind up back at square one: if the tests are acknowledged to be primitive and unreliable, what are we supposed to base our epidemiological data on?

They began testing the blood supply around 1984 or 1985 if I recall correctly, and that's considered reliable enough and safe enough to allow transfusions to proceed. Can we stick to that as our yardstick? Testing of the US blood supply? Because from everything I can see that's what these figures are founded up on: what's found in the general blood supply, military recruits, and what hospital labs and doctors offices report finding en masse.

As for Africa: I've been trying to restrict to the US solely for the purposes of keeping the discussion simple, and hoped to address Africa at another time. I won't say no, but... I really think waiting a bit longer would be prudent.
1.26.2005 6:46am
maor (mail):
500,000-1,000,000 in 1985 to 1,000,000-1,500,000 in 1987 to less than 1,000,000 in 1996 is a flat curve?
1.26.2005 7:44am
maor (mail):
Dean,
Blood donors and military recruits showed HIV rates which suggest far less than 1 million HIV carriers. It was assumed that this is because high-risk groups are left out (i.e. not too many homosexuals among the recruits). There is no data that gives 1 million HIV carriers without certain debatable assumptions. Hence the enormous range mentioned in the 1987 report:
"The range of estimated values is large, from 276,000 to 1.75 million persons infected, reflecting both uncertainty in the progression rate for AIDS and the varied assumptions about the shape of the underlying infection curve. With use of only the best estimate of the disease progression rate from the San Francisco prospective study, the range of estimates is smaller, from 420,000 to 1.65 million."
1.26.2005 7:54am
maor (mail):
"Serious question for the audience: why were gay men, most of them in their teens and 20s, dropping like flies in the early 1980s from an infectious disease with an average latency period of ten years?"

Sorry about the multiple posts, but hey, you asked :)
Answer: Because there are many cases where the latency period is more or less than the average value.

BTW, when did you hear the establishment say that HIV leads to death within a year?
Curran et al. (1985) refer to a lag as if it was well known, and the 1987 CDC report refers to a 1986 report that 20-30% of HIV carriers develop AIDS within 5 years. I mean, HIV was only discovered in 1984!
1.26.2005 8:12am
Brian (formerly bb) (mail) (www):
Dean -
Thank you for sticking with this. I've been reading - but not contributing - because I haven't had anything worthwhile to add. And because there's been too much of it for me to keep up with.

Don't let some snarkiness in some comments get you down. You know that people with strong opinions are more likely express them. Even moreso when their opinion opposes yours. You're triggering a lot of thought, here - and probably most of those thoughts don't turn into published comments.

Keep it up.

(...back to lurking, now...)
1.26.2005 8:13am
maor (mail):
Dean,
I guess you can't play the drinking game for AIDS vaccine predictions. Too bad, it's fun!

Anyway, I think the CDC might debate your claim
"by all accounts--there are tons of people out there testing HIV+ who simply are not showing up as AIDS cases because they aren't telling their doctors and aren't seeking treatment for it."

The CDC believes it has found the large majority of HIV carriers by widespread testing among high-risk groups. And these HIV carriers do show a strong tendency to develop AIDS.
1.26.2005 8:50am
Jeremy Parker (www):
I was gonna go through and check the sources, and in doing so I found this statement from http://www.cdc.gov/mmwr/preview/mmwrhtml/00001894.htm:

"On the basis of these back-calculation analyses, CDC now estimates that approximately 750,000 persons in the United States were infected with HIV at the beginning of 1986 (Table 1). Estimates of current HIV prevalence based on these analyses range from 650,000 to 1.4 million. The median of these estimates is greater than 900,000, and only one estimate is less than 850,000. The wide variation among the estimates for recent years reflects the sensitivity of the back-calculation approach to more recent surveillance data reports and to varying estimates of the distribution of incubation times.

The group agreed that back-calculation provides a basis for estimating past HIV-infection prevalence and future AIDS incidence. However, the accuracy of this method depends on the validity of the necessary assumptions and adjustments made, especially those concerning the completeness of AIDS case reporting and the estimated distribution of incubation periods. Current estimates derived from empirical data."

First, it seems they wanted to change their 1986 estimates...lower (although the next paragraph is vague as to whether that was accepted). But the other important point is that they are making these projections based on AIDS and HIV data...not just HIV data. It's a back calculation that assumes HIV causes AIDS. No? Am I missing something?

At any rate, I don't like the idea of picking the high end of Curran's numbers and the low end of the next set of numbers to fit the graph.

Enjoy the discussion!
1.26.2005 9:34am
Samba Diallo (mail):
Maor:

Then if I follow you, for all we know, HIV infection in the population is not known, and has never been known with nothing resembling accuracy. Duesberg et al should have plotted the min/max guestimate for each year on their HIV plot (reproduced above) instead of the round one million the CDC uses most of the time. That's resonable enough. Now that we know it, where do we go next? Because the min/max keeps oscillating pretty much the same. For all we know, HIV infections could have gone up in the last 20 years, down, or, in fact, up AND down, or down AND then up. So estimations of HIV based from testing several million blood donations every year, a couple of million applicants to the armed forces every year, and an unknown quantity of tests done upon physician request every year, have not contributed to knowing where, when and if HIV is spreading or not in the population outside those same risk groups that came down with AIDS to begin with.

After 20 years of massive testing, adding to a total of, I don't know, a few dozen million different people (because some donors may have donated twice or more, and some army applicants retried later, and some other people got tested several times ...). Does anyone know, more or less, how many zillions of HIV tests have been done in the US (counting only those whose result would have been reported) since "the test" appeared (and trying to minimize redundancy)?

So, if the epidemiological guestimates of HIV as detected by "the test" fluctuate so wildly according to "underlying assumptions", how do we relate them to AIDS? Or to anything else, for that matter. Which I think is the point Duesberg has been trying all along to communicate.

As Jeremy suggested, it seems that the causal HIV=AIDS link was assumed from the very beginning. Could it possibly be retrospectively justified from the wildly fluctuating HIV numbers?

As the immortal Mark Twain once said, "there three kinds of lies: lies, damn lies, and statistics".

Samba
1.26.2005 9:53am
Samba Diallo (mail):
Dean, I just have to add this. Please. I hope I don't get kicked out, but if HIV testing HUGE relative samples of the population in the US gives these problems Maor has called our attention, then can you imagine estimating Africa?
1.26.2005 10:22am
maor (mail):
Samba,
Yes, HIV and AIDS cannot be linked by comparing HIV and AIDS prevalence in the general population.
However, that was never the case.
HIV was linked to AIDS by the near 100% HIV prevalence in AIDS patients, the correlation between HIV and death of individuals, and by the correlation between HIV behavior and AIDS symptoms.
1.26.2005 10:38am
maor (mail):
"there three kinds of lies: lies, damn lies, and statistics"

Of course, a statistician will say that Twain was referring to inappropriate use of statistics to make an incorrect point. IMHO, that's what Bialy did.
1.26.2005 10:40am
jfr (mail) (www):
maor,

but correlation doesn't mean causation.
1.26.2005 11:23am
Samba Diallo (mail):
Maor:

You are quite right: "HIV was linked to AIDS by the near 100% HIV prevalence in AIDS patients, the correlation between HIV and death of individuals, and by the correlation between HIV behavior and AIDS symptoms".

I find interesting, though, that after 20 years "HIV behavior" continues to correlate very well with AIDS, whereas HIV test-based estimations do not, we all agree now, correlate very well with anything. AIDS continues mostly restricted to risk groups and estimations into the general population..., well, see above.

However, I would have expected, with the benefit of hindsight, that those 20 years and zillion HIV tests would have added confirmation to the original underlying assumptions, not muddled them.

And I also agree with you that a statistician would say just that too. It was only a jocular comment. But the fact remains that the CDC used those same shaky stats to terrify everyone, with or without "HIV behavior", by placing almost exclusive emphasis on HIV and excluding the behavior bit (if you have to keep shooting up, use clean needles, etc). Which leads us to some of the very questions Dean put forth when starting this new thread.

Samba
1.26.2005 11:26am
Jeremy Parker (www):
Samba,

"So, if the epidemiological guestimates of HIV as detected by "the test" fluctuate so wildly according to "underlying assumptions", how do we relate them to AIDS?"

I think the point I'm trying to make is:

1. Trying to disprove an assumption based on numbers that rely on that assumption is...well...difficult.

2. the argument can be made that in 1985 the data could be read to mean 500k were infected. In 1990 or so the CDC reestimated the 1986 prevalence to be around 750k and the 1990 estimate to be 1 million. I think that's my only problem with this data. I see the graph as rising from the late 70's (?) early 80's until a plateau was reached (reached for a multitude of reasons).

I'm just not convinced HIV doesn't cause AIDS.
1.26.2005 11:31am
Jeremy Parker (www):
jfr,

I think maor knows that correlation doesn't equal caustion...lol, but as has been stated before, there are other reasons for thinking HIV causes AIDS...not just the fact that "HIV and AIDS have been linked in time, place, and population group." ( I believe that's how the phrase goes...lol)
1.26.2005 11:43am
Nathan of Brain Fertilizer fame (mail) (www):
I think the concept that "Behavior = AIDS" rather than "HIV = AIDS" is a socio-politically untenable idea, regardless of its potential accuracy.
With all seriousness, people have planned and/or contracted murder over less important issues.
1.26.2005 11:51am
Samba Diallo (mail):
Jeremy, I agree. The guestimates could also be used in a descending trend or in just about any trend. So they don't tell us anything, which is a point that Maor has made and which I agree with. Duesberg only quoted the averages as used by the CDC.

Of course that it is pointless "Trying to disprove an assumption based on numbers that rely on that assumption". I agree with you and I am not trying to do that. But if zillions of HIV tests still don't tell you anything, then I think we are back in 1987 and questioning HIV as a pathogen on virological grounds, as Duesberg did in the Cancer Research review on retroviruses.

The epidemiology may find correlations and, as the statistical science that it is, it can expect to confirm/change many things as samples get bigger and bigger. And, in my opinion, it has. It has confirmed that "HIV behavior" still correlates very well with AIDS and that the "explosion"into the general population has not occured (not in the US and Europe, at least; but I don't want to get goin' on Africa ..., not yet anyway).

I hope you don't get the idea I am trying to convince you of anything. You express your doubts about some ideas, and I do the same. Civilly, amicably, and we leave it for the rest of the readers to benefit from our exchange. That is all.

Samba
1.26.2005 12:01pm
Jeremy Parker (www):
Samba,

Oh I agree you're not trying to convince me of anything. And I appreciate your argument. I actually think Africa is probably more proof...but nobody wants to go there (understandably b/c Africa, as a general rule...sucks politically and probably can't be trusted). You're right, the explosion into the general population wasn't there...but that's part transmission issues and part social issues (difficult with standard heterosexual sex to transmit--we've discussed this previously). But that argument doesn't seem compelling enough to me to disprove the other stuff (spelled about by NIH/CDC, etc)

At any rate, I find the more medical/science based stuff more appealing than the epidem. stuff. Like the success of current HAART regimines ((viral load goes down, CD4 goes up...AIDS symptoms disappear).), immunoligcal aspects, etc

I suppose my final point is that finally I don't feel so bad about scrambling to find reasons for the HIV consistency shown in the graph. The graph was made on the assumption that HIV caused AIDS (problem 1), the 1985 data was stretched (and probably made on loose assumptions that weren't later made--problem 2) and the 1986 revision to 750k ignored (problem 3).

I'm also just happy this discussion has remained sane for like...20 posts or so. YES!!

And I have got to stop using () so much. Sheesh.
1.26.2005 12:16pm
Samba Diallo (mail):
Jeremy, I wonder if you really want the debate to stay "sane", as you put it.

Africa, as a rule, may suck politically according to you. But Western reporting about how much exactly Africa sucks, and why, and where, and how, sucks far more than Africa itself, and is not to be trusted either.

Try to be less offensive, we are talking science, not politics, and the internet is global, and Dean did not specify that you have to be from the developed world to participate.

I wonder how many people would jump to my throat if I said that, as a rule, America sucks. And if that would not be enough for Dean to, justifiably, cut me off the thread.

Samba
1.26.2005 12:42pm
Jeremy Parker (www):
Samba,

Okay, I do want sanity for the thread--I really don't know how I've proven otherwise.

And the overall generalization of the politics of Africa was probably a bit grossly overstated on my part. I think my point was meant to be the same as yours...the numbers from everyone are to be taken with somewhat of a grain of salt concerning the continent.

Forgive me for offending you.

Back to the science.

J
1.26.2005 12:59pm
Nathan of Brain Fertilizer fame (mail) (www):
Samba, I think you make a really good point, at least tangentially:
Supporters of the HIV = AIDS theory are saying that the theory was established in good faith with acceptable information established to within acceptable tolerances, and there just isn't enough certainty in the counter-evidence to do anything.
Opponents of the HIV = AIDS theory are using logical chains of supposition to demonstrate that HIV = AIDS.
Now, I'm pretty much in the "Opponent" camp spearheaded by Dean (although I was there months before he even started).
It seems to me, much like the Monty Haul Door Puzzle Dean brought up again to bolster his point, if you can't see/understand the logic, you deny it is even there.
It's like a logic puzzle. On the surface of it, 5 simple statements could not give you enough information to determine what nationality lives in what color house, drinks what beverage, smokes what tobacco and has what pet...but if you rigorously follow all the implications, the answer is clear. That's what Bialy, Duesberg, and Dean are doing.

What bothers me the most about all the arguments is that some of the supporters of the HIV = AIDS theory consider their own impressive-but-not-exactly-relevant-credentials and native layman intelligence to be good enough to refuse to credit Dean's own native intelligence to make these logical conclusions. And further, are using those same credentials/intelligence levels to refuse to consider and evaluate the chain of conclusions.

It's frustrating.
1.26.2005 1:26pm
willem:
"I'm just not convinced HIV doesn't cause AIDS."

Is this really what the discussion should be about? It can be difficult to prove a negative given the state and history of these data. Sometimes it helps to use the doctrine of reasonable certainty. From this perspective, I've arrived at the uncomfortable opinion that the orthodoxy's presumption of causality is suffering from a fatal abundance of premature conclusions. I think this is an important part of Dueberg's point that many seem to have missed. Positing the central question as: "If HIV does not cause AIDS, what does?" means we must move away from the position "...but HIV must cause AIDS... and therefore we must divert all funding and push research efforts in that direction."

The matter is quite enigmatic. Even those data used as arguments for orthodoxy's case have difficulty rising to a reasonable certainty that HIV "causes" AIDS. Yet this has manifested in public health and university policy in abundantly perverse ways. The mistreatment and blacklisting of Duesberg certainly provides an example of such perversion.

How does one definitively answer a question that is not yet sufficiently understood? Perhaps this point is Duesberg's greatest contribution to the debate. Duesberg and crew have certainly demonstrated a reasonable certainty that AIDS causality is not well understood by present orthodoxy.
1.26.2005 1:42pm
maor (mail):
Samba,
Ypu say:
"I find interesting, though, that after 20 years "HIV behavior" continues to correlate very well with AIDS, whereas HIV test-based estimations do not, we all agree now, correlate very well with anything."

1)By "HIV behavior", I meant the physiological behavior of the virus in the body (i.e. it infects the same cell type which is depleted in AIDS)

2)HIV estimates DO correlate with AIDS cases (A bit over half of HIV carriers who ever lived have already developed AIDS). Of course, HIV estimates are partially based on AIDS cases, so this would be expected.
Only the TRENDS in HIV estimates are too fuzzy to be of any use (The early estimates at least. More recent estimates might be useful for predicting the future, but the future is in the future, eh?).
1.26.2005 2:18pm
maor (mail):
jfr,
Yes, correlation does not equal causation. That's why it's important to have a reasonable mechanism.
And to make predictions that HIV will cause death in similar groups of people.
That's why I included those in the list.
1.26.2005 2:21pm
daf9:
Nathan writes: "What bothers me the most about all the arguments is that some of the supporters of the HIV = AIDS theory consider their own impressive-but-not-exactly-relevant-credentials and native layman intelligence to be good enough to refuse to credit Dean's own native intelligence to make these logical conclusions. And further, are using those same credentials/intelligence levels to refuse to consider and evaluate the chain of conclusions.

It's frustrating."

Speaking as an AIDS Apologist, I think I can say the frustration is mutual. My perspective is that all data is not equal and cannot be given equal weight. I expect that's your perspective or Dean's perspective as well. But we disagree on which data should be given the most weight.

For example - in reconciling these two graphs of hiv versus aids incidence/prevalence. If I ignore the clinical latency of the virus (for which there is all kinds of evidence based on following what happens in hiv infected individuals), if I ignore the fact that public awareness has reduced high risk behaviours(based on questionaires given to high risk individuals), if I ignore the large measure of uncertainty that was necessarily a part of the early estimates (because the definition of AIDS was changing, the estimates of latency were changing, the proportion of at risk people being tested was changing), if I ignore the studies that say that treatments have reduced mortality and more recent treatments (i.e. HAART) may also be reducing transmission - if I ignore all these things then I agree completely that I cannot reconcile those two graphs. However, since all those things are part and parcel of the hiv/aids hypothesis, I can't ignore them and so I don't see the graphs as requiring explanation.
1.26.2005 5:14pm
Hank Barnes (mail):
Hi Dean,

I find this topic you've waded into quite interesting and informative.

Duesberg makes another point about the drugs used to treat AIDS, namely this one little bugger called AZT. Here's my formulation:

1. AIDS stands for Acquire Immune Deficiency Syndrome. The key is the I &D.

2. Immune Deficiency means drop in white blood cells. These are the buggers that fight all foreign antigens (ie, bacteria, viruses, fungi, etc) and keep you from becoming maggot bait (until you die, when they stop working.)

3. A virus or anything else that can kill your white blood cells would, in fact, be devastating.

4. There are about 11 or so different white blood cells (Leukocytes, Monocytes, neutrophils, eosophils, macrophages,etc, etc.)

5. This is like saying there are 11 different types of policmen (detectives, seargents,captains, patrolmen).

6. HIV purports to kill one type of white blood cell only -- the T-cell. Perhaps, this is analogous to killing only the detectives at the police station, but not other cops.

7. However, AZT kills all types of white blood cells -- the whole lot. The whole police force.

8. It does this by terminating the DNA of any and all quick-dividing cells. It cannot differentiate between the DNA of a virus and the DNA of a cell. In fact, the latter has millions of more nucleotides than the former. It is a much easier target.

9. Therefore, AZT actually makes AIDS patients worse, not better, by killing the virus, the T-Cells, and all other white blood cells, as well. It thoroughly devastates the immune system -- but then, these AIDS specialists blame the pathologies on the virus.

10. It would be like overprescribing cancer chemo to cancer patients, killing them and then blaming it on the cancer.

Same principle.

Anyone wanna tackle this on the merits? Bring your "A" game:)
1.26.2005 5:55pm
Nathan of Brain Fertilizer fame (mail) (www):
Daf9,
You make an excellent point about the weight each side correspondingly gives differing evidence.
However, your very first example is the introduction of a strawman, and an extremely inaccurate one at that:
You don't have to "ignore latency" to see Dean's graphs as indicating the idea that HIV does not cause AIDS. In fact, to preserve the theory that "HIV Causes AIDS", you have to use the concept of latency in ways in was never meant to be used, almost as a magic wand to wave away any data irregularities that would undermine the "HIV Causes AIDS" theory.
The second is another strawman: as soon as AIDS-treatment drugs hit the market, 'safe sex' went out the window for a significant population of homosexuals, if not heterosexuals. I don't think 'safe needle use' ever really caught on. And there was a report just about a year ago about a significant increase in syphillis infections among homosexual males...but no corresponding significant rise in HIV/AIDS sufferers. That cannot compute...
And the "inaccuracy of early data" isn't a winning argument for your side, either. It's already been refuted. Heck, if your side was right that HIV Causes AIDS and that AZT saves lives, then the death rate of high-risk groups mustgive us extremely accurate estimates of the early rate of HIV prevalence. If it doesn't, then that already invalidates the HIV=AIDS theory.

However, despite what I respectfully consider to be insufficiently compelling examples, your point remains exactly correct: a difference of focus is probably causing both sides to talk past each other, much like the blind men and the elephant.
1.26.2005 6:20pm
IB Bill (mail) (www):
Side issue: I lived in Africa. It doesn't suck. Not by any stretch of the imagination. Vast, green, wild, wonderful ... you have to go.

Seriously. It doesn't suck. Go, but be careful.
1.26.2005 6:37pm
daf9:
Hank Barnes writes: "...Duesberg makes another point about the drugs used to treat AIDS, namely this one little bugger called AZT.....7. However, AZT kills all types of white blood cells -- the whole lot. The whole police force.

8. It does this by terminating the DNA of any and all quick-dividing cells. It cannot differentiate between the DNA of a virus and the DNA of a cell. In fact, the latter has millions of more nucleotides than the former. It is a much easier target.

Anyone wanna tackle this on the merits?"

Okay Hank. First to clear up a misconception of how AZT works. Within the cell there are pools of deoxyribonucleotides that are required to replicate DNA. For the cell's DNA the replication process requires an enzyme called DNA polymerase. When DNA polymerase incorporates AZT it will stop the replication process at that point. The enzyme required for viral replication is a different enzyme called reverse transcriptase. Reverse transcriptase is killed by lower concentrations of AZT than cellular DNA polymerase is.

The evidence that AZT really works this way in people is the observation that when hiv negative people are treated with antiretroviral medications including AZT (which is done for people who have been exposed to hiv containing blood to reduce the chance of infection) - in those people AZT causes no changes in CD4+ T cell counts.

In contrast when hiv positive people are treated with antiretroviral medications including AZT they show dramatic increases in CD4+ T cell counts and the increases in T cells generally correlate with the extent to which viral loads are reduced.
1.26.2005 8:13pm
Shad:


First, since the original graphs each cited the CDC as the sole source of these numbers, and since the conclusion drawn depends on that being the case, I think it's appropriate to dismiss as irrelevant any numbers not provided or endorsed by the CDC.

Second, since the graph was first contained in a paper published in a respected, peer-reviewed scientific journal, I am confused as to why these references detailed in this post do not appears as citations or in the reference list of the paper in question.

Last point regarding documenting sources: the text below the graphs in the article by Mr. Bialy that was published here as a Single Damning Demonstration the HIV could not be the cause of AIDS claims The data in the above graphs comes from the US, CDC.HIV/AIDS Annual Surveillance Reports for the years indicated. That is clearly not the case and it is entirely appropriate for critics to have questioned where the numbers really did come from.


Next, I'd like to point out that no one here has disputed that various estimates for HIV prevalence at various times have been given. In fact, just about every post on this thread says as much. The dispute has been over the quality of the estimates, the source of the estimates, and whether the data from those estimates were being represented accurately.

Almost all of the references provided in this post draw their numbers from one of two places: a late-1980's working estimate (the Coolfont report from 1986, which I wasn't able to find online) generally accepted by the CDC which provides the 1.0 to 1.5 million range estimate repeated in most of the references, and a 2000 estimate used by the CDC [Fleming, P.L. et al. HIV Prevalence in the United States, 2000. 9th Conference on Retroviruses and Opportunistic Infections, Seattle, Wash., Feb. 24-28, 2002. Abstract 11.] which provides the 850,000 - 950,000 range estimate repeated in the other references. The majority of references listed simply repeat estimates provided by other sources; they are not purporting to provide any update, revision or validation of these estimates. In other words, these non-primary sources provide no useful data and should be discarded.

The only reference supplied which does not repeat either the 1986 estimate numbers or the 2000 estimate numbers is the 1996 HRSA "State Estimates of Clients Served by CARE Act Providers" study. This study uses an unsourced and unexplained estimation of 1996 HIV infections in the range of 650,000 - 950,000 persons.

Also, there are no references for any of the intervening CDC estimates, such as this one from 1990 (HIV Prevalence Estimates and AIDS Case Projections for the United States: Report Based upon a Workshop / Appendix A / Appendix B) which offer revised current estimates and revised back-calculated estimates for prior years (e.g. this report revises the 1986 HIV prevalence estimate downward to 750,000).

So, ultimately, there are three sourced HIV prevalence data points to work with from the CDC references given in this list -- 1. the 1986 Coolfont range of 1.0 to 1.5 million, 2. the 2000 Fleming range of 850,000 to 950,000, and 3.the 1996 HRSA study range of 650,000 to 950,000. (And in fairness, the HRSA data point ought to be discounted because a. it's unsourced within their report, and b. the graph purports to be using only CDC data.)

From these three data points sprang a graph showing a continuous HIV prevalence of 1 million persons from 1985 to 1995, dropping to a continuous 900,000 persons from 1996 to 2000.

It still looks to me like there are big problem with this graph and its conclusions. To summarize the problems I noticed with these references and the graph:

* Citing non-CDC sources for data claimed to be from the CDC
* Citing sources that were not cited in the original Duesberg / Koehnlein / Rasnick paper which contained this graph
* Citing sources that were not cited in the Single Damning Demonstration article by Mr. Bialy which contained this graph
* Data provided in sources are all estimates, although they have up to this point been presented as hard data
* Data provided in sources are all bounded ranges, although the graphs represented only specific numbers within those ranges
* No inclusion of the intervening CDC sources which provided revisions and corrections to earlier estimates as new data became available
* Most references simply repeat estimates (sometimes with, sometimes without citation), and are not primary sources of data
* The fifteen-year graph is based on only 2 CDC estimates, made in 1986 and 2000, although data points are represented on the graph at years 1985, 1990, 1995, 1996, and 2000.
1.26.2005 8:19pm
Janelle :
Dean, just a quick note. Your work has been absolutely outstanding.

Many people know I was diagnosed with a double wammy of immune disease and over the last year have gone through some horrible times with sickening side effects that took my mind up and down into depths I would sincerely never wish on anyone not even a so called enemy.

Since changing a lot of habits and believeing 100% in the medical establisment I went down hill. One drug, two, three six to ten with all side effects making me so sick and nausea that I started wiening myself off. If getting better meant ALL that hell, then I just wanted it to stop and the ups and downs as witnessed here in my posts showed that not enough is done in other areas of healing.

I am a walking, yes I say walking testimony. I moved from Chicago with the immune diseases of RA/Lupus and used a cane when I boarded that plane.

Question the medical field, never do what I di for so many years. I believed in alternative medicine but it wasn't until I was ready to give up that I found a fabulous chiro and natural healer. His partner works with sports medicine and athletcs come from all over.

Dr.Clayton and I will be putting out a newsletter and our first subject will be immune disease and will lean to RA but we will send you a copy and are probably looking at a way to incorporate your blog and other's that I know would benefit whole heartily. I am walking and sitting like when I was a young woman and even going to start ballet soon as it will enhance the stop the degenative bone disease.

Keep up this HIV, it is outstanding work and Dr. Clayton and me will be getting a hold of you in the future. My Body Flex has him thrilled for me and we are putting on a program in Febuary and I will be a Big Part of it.

Good for you hanging in there. Oh, I can not e-mail as someone we know took over somethings and it is not a family member but down the road you will know as my soon to be disconnect of this address and police going over all the things done during and still going on due to identity theft.

I'll be back and give the children a hug please. I am one busy woman trying erven harder now.

One more time...great work on the HIV and immune system!
1.26.2005 9:38pm
Dean Esmay (www):
Got a note this morning from Harvey. He wanted me to post this:

Hi Dean,

The letter transcribed below was composed in the between of 8.30 and 9.00 am this manana. Like most of my writing, it speaks for itself, and like most of my speaking it requires a little prefatory initiation to discern any possible gold dust from its presumptive auhtor from the fool's dust that looks often to be indistinguishable.

It, like the attachments, are intended to show your readers that myself and the other "HIV/AIDS" insurgents who are represented in this multi-logos about HIV/AIDS, bio-logos, scientific thinking and Thinking in general, are eager to have full documentation of the photographic and other indisputable varieties out on the biggest possible table for absolutely, positively, most definitely anybody (even the Rain Main, no most especially the Rain Man) to inspect for themselves.

Only go "Don't Know Mind", Get Dharma Gasoline and Save Every Body from needless and useless suffering.

Your buddy in the blogospheres, and other cyber-celestial realms too,

harvey

-transcription of the "letter from bialyzebud"-attached--------------------

Hi Dean,

Thanks for All of the above and sideways too!

I think your readers might wish to know that a condensed version of the incredible, not to say even unbelievable discussion we started, with an insightful and delightful "commentary" by one of the World's finest living minds (even if I do say so myself) will very shortly appear in Dean's World , and All will be able to come to independent determinations based on analysis of the " simple truth" ("true-Truth" as the most excellent biochemist Michael J.. Chamberlain is fond of calling it, is Never complicated. Speaking personally (is there any other way?): It is The Most important lesson I have learned from 40-odd (very) years as a (sic) professional molecular biologist (a very dicey term indeed according to Samba's favorite biochemist the late, great Erwin The Snide and Disgruntled Chargraff -.a little like me, and Samba too I think).

They will then be able to see for themselves what can happen to a perfectly good, but absolutely average working mind after 20 years of "thinking" about HIV/AIDS, and what attempting to answer its deceptively simple, and very tricky teacher-type Question and questions can do to minds both considerably better and worse -- the whole Gaussian schemer so to speak of the high-IQ end of the intelligence spectrum. None of it, II assures you is the least bit pretty, although i think it is extremely instructive instructive. But what do i know? Almost as little as my fiend Duesberg according to some of the alphabetically enabled, colorful characters in the cosmic divine comedy/tragedy coming soon to Dean's World.

In the between, as i like to say, here are a few additional materials you might want to have now, as they directly relate to the points raised earlier (1.26.2005 6:33am).by my new cyberpal Dr. Samba Dialla, residing somewhere, Ii guess, on the dark so-called by some blind persons continent, but which those of us who proudly call Mr. Thabo Mbeki, President, more properly addressed as Mother Africa.

1. The Experiment Protocol agreed to by ALL MEMBERS of the President's HIV/AIDS Advisory Panel after its deliberations in 2000. This internal report, as well as the other materials provided here, have hitherto only been available privately, although some reference to them is made in what Peter and I like to call the "F. Book".

2. An annotated chronology of the events transpiring in the between of the report above and the initiation of the first pilot studies in May 2003.

I hope this will satisfy Dr. Dialla, as well as enlighten your very, very many highly intelligent Readers.

Your bud,

Only go don't know mind Bialy

P.S. When you place this, please place around it one of those striking green borders.

P.P.S. In case any one of your Readers is wondering Y i didn't post this myslef, i should explain that formulating and (sic) leading the wild and crazy seminar has left me quite exhausted and in need of a break from the front - sometimes crooked and otherwise curved, and sometimes very straight indeed, but none-the-less all: lines of battle..
1.27.2005 4:33am
Dean Esmay (www):
Attachments from Bialy:

Letter to Esmay

Elisa dossier

Preadsorption Protocol version 7.

Harvey's one wild dude. %-)
1.27.2005 4:42am
maor (mail):
Hank,
#8 is all wrong for reasons that daf9 pointed out.

More importantly, you got a reference for the claim that AZT kills all white blood cells? (At clinical doses, of course)

I looked at Duesberg's sources, and I didn't find such a source.
Interestingly, Duesberg referenced a DOUBLE BLIND STUDY [didn't someone ask for such a study?] which found that AZT LOWERS MORTALITY [presumably by delaying AIDS death] and RAISES CD4+ T-CELL COUNTS and PREVENTS OPPORTUNISTIC INFECTIONS.
Why?
Because the study also found death of red blood cells and neutrophils. Which he cited as evidence that AZT ruins the immune system.
Odd.


N Engl J Med. 1987 Jul 23;317(4):185-91.

The efficacy of azidothymidine (AZT) in the treatment of patients with AIDS and AIDS-related complex. A double-blind, placebo-controlled trial.

Fischl MA, Richman DD, Grieco MH, Gottlieb MS, Volberding PA, Laskin OL, Leedom JM, Groopman JE, Mildvan D, Schooley RT, et al.

We conducted a double-blind, placebo-controlled trial of the efficacy of oral azidothymidine (AZT) in 282 patients with the acquired immunodeficiency syndrome (AIDS) manifested by Pneumocystis carinii pneumonia alone, or with advanced AIDS-related complex. The subjects were stratified according to numbers of T cells with CD4 surface markers and were randomly assigned to receive either 250 mg of AZT or placebo by mouth every four hours for a total of 24 weeks. One hundred forty-five subjects received AZT, and 137 received placebo. When the study was terminated, 27 subjects had completed 24 weeks of the study, 152 had completed 16 weeks, and the remainder had completed at least 8 weeks. Nineteen placebo recipients and 1 AZT recipient died during the study (P less than 0.001). Opportunistic infections developed in 45 subjects receiving placebo, as compared with 24 receiving AZT. The base-line Karnofsky performance score and weight increased significantly among AZT recipients (P less than 0.001). A statistically significant increase in the number of CD4 cells was noted in subjects receiving AZT (P less than 0.001). After 12 weeks, the number of CD4 cells declined to pretreatment values among AZT recipients with AIDS but not amonG AZT recipients with AIDS-related complex. Skin-test anergy was partially reversed in 29 percent of subjects receiving AZT, as compared with 9 percent of those receiving placebo (P less than 0.001). These data demonstrate that AZT administration can decrease mortality and the frequency of opportunistic infections in a selected group of subjects with AIDS or AIDS-related complex, at least over the 8 to 24 weeks of observation in this study.
1.27.2005 4:55am
Samba Diallo (mail):
From Debating AZT by Anthony Brink (Nov. 2000), linked by jfr in some other related thread.

[19] The negative Concorde trial results were entirely on par with those of an earlier French trial. In 1988 in the Lancet, Dournon et al had published a study of AZT, conducted at the Claude Bernard Hospital in France. It was wider and longer than the American Fischl trial that had preceded FDA approval, and at the end of it the researchers found AZT to be “disappointing.” They noted, “The bone marrow toxicity of AZT and the frequent need for other drugs with haematological toxicity meant that the scheduled AZT regimen could be maintained in only a few patients… by six months, these values [i.e. initial modulation of p24 antigen levels] had returned to their pretreatment levels and several opportunistic infections, malignancies and deaths occurred” - by nine months, about a third dead, another third very sick. But most significantly for the idea that AZT exerted an anti-HIV effect, “full-dose AZT for 2 months did not eliminate antigenemia in patients with pretreatment p24 levels of 200 U/ml or higher...[so] in AIDS and ARC patients, the rationale for adhering to highdose regimens of AZT, which in many instances heads to toxicity and interruption of treatment, seems questionable.” It bears emphasising that the dose was 200mg every four hours, the standard officially recommended dose, and the same as the dose given during the pre-approval Fischl trial in the US, yet the reported outcome was completely different.

Emphasis mine.

Samba
1.27.2005 6:13am
maor (mail):
It's easy to see how that would be disappointing, but it's hard to see how a transient improvement of T-cell levels defends Hank's idea that AZT kills all white blood cells.

-Fischl found that high doses of AZT prevents AIDS DESPITE being toxic.
-So did Volderbing et al.
-Dournon found that high doses of AZT are very toxic and stopped the study.
-All saw AZT increasing, not decreasing, CD4 T-cells, at least temporarily.
-AIDS patients suffer from very low CD4 T-cell levels.
-Lower doses of AZT prevent AIDS and are not particularly toxic.

It isn't too hard to see that AZT toxicity might not cause AIDS. It causes low red blood cells and neutrophils. Fine. But calling that "immunotoxicity" and implying that T-cells are killed is quite misleading when all the studies find an increase.
1.27.2005 7:23am
Samba Diallo (mail):
FDA DOCUMENTS SHOW FRAUD IN AZT TRIALS
By John Lauritsen
New York Native 30 March 1992


After an arduous three-month battle with the Food and Drug Administration (FDA), I have finally obtained documents which describe in detail many acts of fraud committed in the conduct of the Phase II AZT Trials. It was on the basis of the Phase II Trials that AZT was approved for marketing by the FDA in 1987.

Anyone who requests government documents under the Freedom of Information Act should be aware that he's in for a hard time. If the requested documents are completely innocuous, then the government will probably lose them through incompetence. If the documents are not innocuous, then dilatory tactics of every kind will be employed, on top of the usual incompetence. If the documents should eventually be found and released, they will be heavily censored.

On 12 December 1991 I filed my request with the FDA's Freedom of Information Staff, asking for various documents pertaining to the multi-center Phase II AZT trials conducted in 1986. My requests comprised the "Establishment Inspection Report" on the Boston center, written by FDA investigator Pat Spitzig, and two sets of minutes, written by Jackie Knight and Mary Gross. Three weeks after filing my request I got an acknowledgment. When I called the woman who sent it to me, she said that all three of my requests had been found, and I would get them soon. A few days later a form letter arrived from another woman, stating that none of my requests could be found, and my search had been completed. I began calling around until finally I got a Freedom of Information specialist within the FDA, Liz Barbakos, who went to bat for me. With her help, the people in Boston were able to re-find the Establishment Inspection Report by Pat Spitzig, and the people in Maryland (the FDA's headquarters) were able to re-find the Jackie Knight minutes, though not those by Mary Gross. Barbakos said I should receive them in a few days.

Weeks went by, and nothing arrived. I called Barbakos again, and she investigated. She called back to explain that the Jackie Knight minutes would be sent immediately, and that Barbara Recupero in Boston had had the Spitzig report on her desk for two weeks, and was waiting for her supervisor to give the OK before sending it. The next morning I got a conference call, with Liz Barbakos and Barbara Recupero on the other end. Barbakos said she wanted me to hear what Recupero had to say. Recupero said that she had no idea what document I was referring to. I then called Pat Spitzig, the author of the Boston Inspection Report, who called Liz Barbakos and told her exactly what the document was. This put an end to the stonewalling, and I received the 76-page report.

Almost every page was heavily censored. Obviously my difficulty in obtaining the document had nothing to do with problems in finding it - they knew where it was all the time. Rather, the difficulty derived from the FDA's unwillingness to let the document see the light of day, and the various censorship decisions that needed to be made once they realized that further stonewalling would be counterproductive.

The Mary Gross minutes are another story. On the first four times I called her, she was always "away from her desk", and my calls were not returned. On the fifth try I finally got her, and expressed my disbelief that she should be unable to find her own minutes of a very important meeting. The next day she called to say that something I said had triggered her memory, and she had found the minutes. She then faxed them to me, and I found that they consisted of a half page of nothing. For reasons I'll explain later in this article, I do not for one minute believe the minutes she sent me are genuine. Indeed, I regard the phony minutes I received as one more form of censorship, one more way the FDA has of circumventing the spirit and the letter of the Freedom of Information Act...


----------------------------------

Odd.

Samba
1.27.2005 7:26am
maor (mail):
I still think it's odd that Duesberg references the Fischl study as evidence that AZT is harmful, when that study found the opposite. If he doesn't trust the study, OK. But why reference it?
It's also a bit misleading to refer to the Fischl study as being shorter than the French study. The Fischl group did a long term study too (same results, except that AZT was less toxic after a longer period).
1.27.2005 7:28am
Samba Diallo (mail):
Maor, the Dournon study was LONGER then Fischl's.

From 100 more things about Dean:

"54) I am very nearly impossible to offend unless you question my intellectual integrity, or are willfully obtuse. If I accuse you of either, you can assume I'm very angry with you. In fact, if I call you "willfully obtuse" or "intellectually dishonest," you can safely assume I'm a lot angrier (or at least more irritated with you) than if I just call you an asshole or a fuckhead."

Samba
1.27.2005 7:33am
Samba Diallo (mail):
From Debating AZT by Anthony Brink, posted by jfr on some other thread.

[16] That AZT is entirely ineffective as a therapy was borne out clearly by the large-scale Concorde trials in Europe, reported by the Coordinating Committee in the Lancet in April 1994: “A total of 172…participants died [169 while taking AZT, 3 while on placebo] …The results of Concorde do not encourage the early use of zidovudine in symptom-free HIV-infected adults.” Embarrassingly for Wellcome, and disastrously for its share prices,the fabulous results of the chaotic American study that had preceded FDA approval of AZT couldn’t be reproduced. The drug was found to have no clinical benefits. Predictably, “Representatives of the Wellcome Foundation who were also members of the Coordinating Committee…declined to endorse this report” and insisted on gerrymandering the reach of its grim conclusions. Even so, the adverse implications of the trial for AZT could not be avoided. One glaring finding was that AZT’s “severe side-effects”, even in cases of patients on low doses quashed any apparent therapeutic value as suggested by raised CD4 cell-counts - about which the Committee noted that the results “also call into question the uncritical use of CD4 cell counts as a surrogate endpoint for assessment of benefit from long-term antiretroviral therapy.” Emphasising the worthlessness of CD4 cell counting in Annals of Internal Medicine in 1996, Fleming and DeMets described it as being “as uninformative [an indication of immune status] as a toss of a coin.” Not that anyone took any notice. Today, patients terrified by their doctors’ mournful announcements of their low cell counts - still taken as a signal of collapsing health and imminent demise - are urged to start with ‘antiretrovirals’ like AZT, following which the prophesy will be faithfully fulfilled. For example, Harrigan et al reported in AIDS in July 2000 that “Triple therapy for HIV infected patients… do not have any unique effects on CD4 cell counts independent of reductions in plasma viral load”, according to Reuters; “The data appear to contrast with recent evidence suggesting that such regimens are able to maintain an immunologic benefit even after plasma viral rebound… The team examined the correlation between CD4 cell counts and plasma viral load over 52 weeks using data from 3 randomized clinical trials… The studies compared dual nucleoside therapy with triple combination therapy that included a protease inhibitor, with or without a nonnucleoside reverse transcriptase inhibitor. The data presented in these randomized double-blinded trials suggest that the specific antiretroviral regimen used neither increases nor decreases the strength of the correlation between the change in CD4 cell count and the change in plasma viral load.”

CD4 cell counting continues to the present day, as if it means anything. And the evidence mounts against multi-drug therapy, a topic deferred for a later look.

------------

Odd

Samba
1.27.2005 7:54am
maor (mail):
Samba,
The INITIAL Fischl study was shorter than the Dournon study.
Later studies by the Fischl group were longer than the Dournon study (for example, Ann Intern Med. 1990 May 15;112(10):727-37).


I'm a regular reader of Dean's World, so I know all about him ;)
Thanks for the warning, though.
1.27.2005 8:00am
Samba Diallo (mail):
From ibid

[18] In fact, not only was AZT found to be useless at the end of the Concorde trials, it turned out to be positively harmful: Phillips et al reported in a letter to the New England Journal of Medicine in March 1997 that “Extended follow-up of patients in one (AZT) trial, the Concorde study, has shown a significantly increased risk of death among the patients treated early.” In another paper in that year, Impact of treatment changes on the interpretation of the Concorde trial, White et al highlighted in AIDS that “participants of open-label ZDV [AZT] still had four to five times the incidence of ARC/AIDS/death of participants on blinded therapy [of which approximately half were on AZT and half on placebo] … The unadjusted hazard of ARC/AIDS/death was 4.6 times higher for participants [in the deferred group] who had received ZDV...after adjustment for latest CD4 this became 1.6 … There was a suggestion of a benefit in terms of [slower] progression to ARC, AIDS or death [with AZT], no effect on progression to AIDS or death, and a suggestion of an increase in mortality.” Walker summed it up in his essay HIV, AZT, big science &clinical failure, “…the Concorde trial results showed conclusively that asymptomatic antibody-positive individuals who took AZT, died more quickly and in greater number than those simply affected by AIDS-defining illnesses.” As Marginal structural models to estimate the causal effect of zidovudine on the survival of HIV-positive men in the September 2000 issue of Epidemiology by Hernan et al suggested too: “Our analysis included the 2,178 men who attended at least one visit between visits 5 and 21 while HIV positive, and who did not have an AIDS-defining illness and were not on antiretroviral therapy at the first eligible visit. By the end of the follow-up (media duration-69 months), 1,296 men had initiated zidovudine treatment and 750 had died”, from which the researchers drew the dazzling conclusion of “a detrimental effect of zidovudine.”

------------------------

Odd

Samba
1.27.2005 8:08am
maor (mail):
Samba?
Perhaps you don't realise it, but I'm not defending AZT (on which I have no opinion). I am debating the idea that HIV carriers die from AIDS only because of AZT.

AZT not reducing mortality despite temporarily raising T-cell counts?
That supports the thesis that HIV, not AZT, reduces T-cell counts.
This is especially true of the statement:

“Triple therapy for HIV infected patients… do not have any unique effects on CD4 cell counts independent of reductions in plasma viral load”

AIDS therapy only raises T-cell counts by reducing HIV!
Tsk tsk!
1.27.2005 8:24am
daf9:
Samba,

The early treatments for AIDS (designed to lower viral loads and raise CD4+ cell counts) worked but were too toxic to be maintained. Newer treatments work better although still with side effects. None of that argues against HIV as a cause of AIDS. It just says the treatments still be improved upon.
1.27.2005 8:24am
Samba Diallo (mail):
From 100 more things about Dean:

55) I don't view ignorance as a bad thing, nor calling someone ignorant to be an insult. But I view willful, correctable ignorance on any matter of importance to be among the gravest of personal sins.

56) I view the pursuit of truth as the highest calling of the human mind. People who engage in circular or unprincipled arguments therefore tend to drive me into a rage. (It's probably that INTJ thing.)

70) I believe in facts. I believe you must always be prepared to surrender everything you believe in the face of an incontrovertible fact. I find people who can't do that to be either sad or infuriating, depending on my mood.

Samba
1.27.2005 8:37am
maor (mail):
I also think that

"Similarly, there was no significant difference in progression of HIV disease: 3-year progression rates to AIDS or death were 18% in both groups" [from abstract of Concorde study report in Lancet]

means that HIV carriers get AIDS without AZT just as well as with AZT.

But I suppose someone somewhere will spin it as evidence that AZT causes AIDS.
1.27.2005 8:54am
Samba Diallo (mail):
The spin maor was alluding to

From Debating AIDS

In 1991 in Laboratory Investigations, Lamperth et al reported Abnormal skeletal and cardiac muscle mitochondria induced by zidovudine (AZT) in human muscle in vitro and in an animal model within three weeks of experimental exposure to “AZT at doses equivalent to the total daily dose used in acquired immunodeficiency syndrome patients. After 19 days, the AZT-treated myotubes in tissue culture exhibited abnormal mitochondria characterized by proliferation…, enlarged size, abnormal cristae and electron-dense deposits in their matrix. The changes were partially reversible after AZT withdrawal. Rats treated with AZT developed weight loss, 100-fold elevation of creatine kinase, and increased serum lactate and glucose.” Corcuera-Pindado et al reported Histochemical and ultrastructural changes induced by zidovudine in mitochondria of rat cardiac muscle in the European Journal of Histochemistry in 1994: “We carried out an ultrastructural and histoenzymatic study in rat cardiac muscle. Groups of animals (3 rats per group) were given drinking water with or without AZT (1 or 2 mg AZT/ml). After 30, 60 and 120 days, the hearts were studied by light and electron microscopy... The ultrastructural study showed a disruption of cristae and an increased size of mitochondria in rats treated with AZT for 30- and 60-days.” Lewis et al reported that Zidovudine induces molecular, biochemical, and ultrastructural changes in rat skeletal muscle mitochondria in the Journal of Clinical Investigations in 1992: “Molecular changes in a rat model of AZT induced toxic myopathy in vivo helped define pathogenetic molecular, biochemical, and ultrastructural toxic events in skeletal muscle and supported clinical and in vitro findings. After 35 d of AZT treatment, selective changes in rat striated muscle were localized ultrastructurally to mitochondria, and included swelling, cristae disruption, and myelin figures. Decreased muscle mitochondrial (mt) DNA, mtRNA, and decreased mitochondrial polypeptide synthesis in vitro were found in parallel. Mitochondrial molecular changes occurred in absence of altered abundance of cytosolic glyceraldehyde-3- phosphate dehydrogenase, or sarcomeric mitochondrial creatine kinase mRNAs.”

[10] In his answer to my essay, Martin admits that AZT destroys bone marrow, but then hedges: HIV “may” be the real culprit. This is a tired old tale rehashed. Mercury and arsenic salts - doctors’ favourites for ages - poisoned the patient, whose death was then blamed on unbalanced humours or germs. That AZT destroys bone marrow is frankly declared by its manufacturer. So let’s not fudge. In 1987 in Annals of Internal Medicine, Gill et al reported Azidothymidine Associated with Bone Marrow Failure in the Acquired Immunodeficiency Syndrome (AIDS): “Four patients with [AIDS], and a history of Pneumocystis carinii pneumonia developed severe pancytopenia [marked decrease in all types of blood cells]…12 to 17 weeks after the initiation of azidothymidine therapy… Partial bone marrow recovery was documented within 4 to 5 weeks in three patients, but no marrow recovery has yet occurred in one patient during the more than 6 months since AZT treatment was discontinued.” In the same year in the New England Journal of Medicine Richman et al reported The Toxicity of Azidothymidine (AZT) in the Treatment of Patients with AIDS and AIDSRelated Complex: “Anemia…developed in 24% of AZT recipients and 4% of placebo recipients (P<0.001). 21% of AZT recipients and 4% of placebo recipients required multiple red-cell transfusions (P<0.001). Neutropenia (<500 cells per cubic millimeter) occurred in 16% of AZT recipients, as compared with 2% of placebo recipients (P<0.001).” The next year, Walker et al followed up in Annals of Internal Medicine reporting Anemia and erythropoiesis in patients with the acquired immunodeficiency syndrome (AIDS) and Kaposi sarcoma treated with zidovudine: “In the current study, transfusion-dependent anemia occurred in 6 of 15 patients with AIDS and Kaposi sarcoma who were receiving zidovudine therapy. All 6 affected patients required their first blood transfusion between 3 and 9 weeks after starting zidvoudine therapy, and each required 4 to 14 units of packed erythrocytes to maintain a hemoglobin level above 100 g/L over a 12-week study.” Consistent with this, Costello reported in the same year, in the Journal of Clinical Pathology that, “Blood transfusion is often necessary in patients with AIDS, especially in those receiving AZT, a drug which produces severe anaemia in a proportion of recipients. Forty nine (36%) of 138 patients treated with AZT required blood transfusion at least once.” For AIDS doctors slow to the point, Harrison’s Principles of Internal Medicine spells it out: “[AZT], used for treating [HIV], often causes severe megaloblastic anemia…caused by impaired DNA synthesis.” Even in the modern age where AZT dosing levels are now hugely reduced, in 1998, in the New England Journal of Medicine, Hymes et al investigated and reported The Effect of Azidothymidine on HIV-related Thrombocytopenia, and found again: “The hematocrit [red blood cell count] decreased in the same patients...with three of eight patients requiring red-cell transfusion by the fourth week of treatment.” So did Mocroft et al in their paper in AIDS in 1999: Anaemia is an independent predictive marker for clinical prognosis of HIV-infected patients from across Europe: “We found that 78.2% of the [HIV-infected] patients with mild or severe anaemia at baseline had received zidovudine”.

[11] In their 1988 paper in the British Journal of Haematology, entitled, 3’- Azido-3’-deoxythymidine inhibits proliferation in vitro of human haematopoietic progenitor cells, Dainiak et al reported their investigation of “the mechanism by which cytopenias develop [i.e. cell depletion, which is]…a serious, dose limiting toxicity of AZT therapy…” Observing that “Anaemia [during AZT therapy] appears to be due to bone marrow suppression [and] nearly one half of patients treated with AZT for [HIV]- associated disease develop transfusion-dependent anaemia due to bone marrow depression”, they concluded from their study that “AZT is a potent inhibitor of haematopoiesis in vitro, and that erythroid progenitors are particularly sensitive to its action. These results may explain the marrow hypoplasia that occurs during AZT administration in vivo.”

[12] AZT reaches and can destroy foetal bone marrow too. In the May 1998 issue of the Pediatric Infectious Diseases Journal, Watson et al at the University of Rochester Medical Center in New York reported the case of an HIV-negative baby born to a positive mother who had been treated with a HAART cocktail of AZT, 3TC and a protease inhibitor, suffering “high output congestive heart failure secondary to profound anemia.” The paediatricians excluded “infection, nutritional deficiencies, congenital leukemia and congenital red blood cell aplasia in the child” and considered the “cause of the life-threatening anemia in our infant…to be in utero erythroid marrow suppression by one or more of the antiretroviral agents administered to the mother.”

[13] Martin alleges that “toxicity in most cases is reversible.” This optimistic jive was flatly contradicted by Mir and Costello just a year after AZT was approved. They reported their concern in the Lancet in 1988 that “bone marrow changes in patients on zidovudine seem not to be readily reversed when the drug is withdrawn. These findings have serious implications for the use of zidovudine in HIV positive but symptom-free individuals.”

[14] Writing in AIDS in 1997, Kelleher et al noted, “Lack of strong evidence exists for sustained immune reconstitution by current therapies [comprising AZT and other drugs, and AZT may] unmask silent opportunistic infections.” Not only can AZT “unmask silent opportunistic infections”, it can exacerbate clinically conspicuous ones. Havlir and Barnes reported in February 1999 in the New England Journal of Medicine that HIV-positive tuberculosis patients treated with [AZT-based] ‘antiretroviral therapy’ developed “paradoxical worsening of disease…in up to 36 percent of [them], characterized by fever, worsening chest infiltrates on radiograph, and peripheral and mediastinal lymphadenopathy…[whereas] only 7 percent of patients who received antituberculosis therapy but not antiretroviral therapy had paradoxical reactions.” On 18 September 2000, Reuters released a report Doctors describe AIDS patients’ medical paradox. It could have been written by a deadpan standup comedian: “Some AIDS patients whose ravaged immune systems have been boosted by taking cocktails of powerful medicines [not even the manufacturers claim this] have been suffering a surprising increased susceptibility to infections, researchers said on Monday. Scientists at Thomas Jefferson University in Philadelphia labeled as a medical paradox their discovery that AIDS patients whose conditions had been improving [according to surrogate markers, not actual health] thanks to treatment with drug cocktails had been coming under attack from opportunistic infections that ordinarily should not have been much of a problem. In a study published [in September] in the journal Annals of Internal Medicine, the researchers said the sometimes-fatal ‘immune reconstitution syndrome’ stemmed from an inflammatory reaction by the newly strengthened immune system to bacteria or viruses already present in the patient. The researchers said the causes of the syndrome were unknown. The researchers said they were startled by the fact that the infections were affecting patients who had been benefiting from so-called highly active antiretroviral therapy (HAART) involving the use of combinations of powerful anti-HIV (human immunodeficiency virus) medicines. The doctors described learning of patients with a typical infection suffered by those with HIV - mycobacterium avium infection… ‘No one is exactly sure what to do against this syndrome yet,’ DeSimone said... More than a year ago, researchers began to see patients with HIV, the virus that causes AIDS, developing infections at times that caught them off guard. The Jefferson doctors said they decided to search the medical literature and speak with colleagues to learn whether others had seen similar developments. They said doctors at other hospitals mentioned infections such as CMV retinitis, an AIDS-related blindness...” A subject to which we will return later. In the case of children, apart from being poisonous to their blood cells, McKinney et al found that AZT didn’t alleviate their secondary infections. In their paper A multicenter trial of oral zidovudine in children with advanced human immunodeficiency virus disease published in the New England Journal of Medicine in 1991, they reported, “Although no control group was available for direct comparison, the improvement in the children in this study closely paralleled the observations in controlled studies of adults receiving zidovudine… Children treated with zidovudine continued to have bacterial and opportunistic infections.” Of the eighty eight children in the study, “One or more episodes of hematologic toxicity occurred in 54 children (61 percent) and neutropenia (neutrophil count, <0.75X10^9 per liter) in 42 (48 percent).” So why prescribe it? [15] Martin’s happy claim that AZT cocktails afford “long-lasting beneficial effects” was refuted in November 1997, when Lemp et al reported in the Journal of Acquired Immune Deficiency Syndrome and Human Retrovirology that with HAART (Highly Active Antiretroviral Therapy), “the treatment benefit is temporary and confers no long-term survival advantages.” Obviously. How could it possibly? Would you nurse your wilting pot-plant with weed-killer? In the clever age, whatever happened to common sense? At last some lay folk are waking up; Steven Gendin wrote an article in the January 1999 issue of the AIDS-drugs-promoting rag POZ, candidly entitled If the virus doesn’t get you, the drugs you take will. He’s seen enough of his friends fade away on AZT to know. In July 2000 he went himself at the age of 34, dead of heart failure - which we will examine below.

[16] That AZT is entirely ineffective as a therapy was borne out clearly by the large-scale Concorde trials in Europe, reported by the Coordinating Committee in the Lancet in April 1994: “A total of 172…participants died [169 while taking AZT, 3 while on placebo] …The results of Concorde do not encourage the early use of zidovudine in symptom-free HIV-infected adults.” Embarrassingly for Wellcome, and disastrously for its share prices, the fabulous results of the chaotic American study that had preceded FDA approval of AZT couldn’t be reproduced. The drug was found to have no clinical benefits. Predictably, “Representatives of the Wellcome Foundation who were also members of the Coordinating Committee…declined to endorse this report” and insisted on gerrymandering the reach of its grim conclusions. Even so, the adverse implications of the trial for AZT could not be avoided. One glaring finding was that AZT’s “severe side-effects”, even in cases of patients on low doses quashed any apparent therapeutic value as suggested by raised CD4 cell-counts - about which the Committee noted that the results “also call into question the uncritical use of CD4 cell counts as a surrogate endpoint for assessment of benefit from long-term antiretroviral therapy.” Emphasising the worthlessness of CD4 cell counting in Annals of Internal Medicine in 1996, Fleming and DeMets described it as being “as uninformative [an indication of immune status] as a toss of a coin.” Not that anyone took any notice. Today, patients terrified by their doctors’ mournful announcements of their low cell counts - still taken as a signal of collapsing health and imminent demise - are urged to start with ‘antiretrovirals’ like AZT, following which the prophesy will be faithfully fulfilled. For example, Harrigan et al reported in AIDS in July 2000 that “Triple therapy for HIVinfected patients… do not have any unique effects on CD4 cell counts independent of reductions in plasma viral load”, according to Reuters; “The data appear to contrast with recent evidence suggesting that such regimens are able to maintain an immunologic benefit even after plasma viral rebound… The team examined the correlation between CD4 cell counts and plasma viral load over 52 weeks using data from 3 randomized clinical trials… The studies compared dual nucleoside therapy with triple combination therapy that included a protease inhibitor, with or without a nonnucleoside reverse transcriptase inhibitor. The data presented in these randomized double-blinded trials suggest that the specific antiretroviral regimen used neither increases nor decreases the strength of the correlation between the change in CD4 cell count and the change in plasma viral load.” CD4 cell counting continues to the present day, as if it means anything. And the evidence mounts against multi-drug therapy, a topic deferred for a later look.

——————————
maor, daf9:

When you are done making propaganda for AZT (at modern low doses, of course) and for HAART, and reasoning circularly, maybe we can examine the early molecular evidence that linked "HIV behavior" and AIDS. Until then, there is a LOT more data where this came from. I have already agreed with you that HIV seroepidemiology is worthless. Let's move on.

Hank: You are right about the pancytopenia, see above in [10]. Even if in vitro the action of AZT (or any other chain terminator) on mammalian DNA polymerases can be distinguished from that that on retroviral reverse transcriptase, we never know exactly how much AZT there is within any given cell of a patient, or even how evenly distributed it is within the cell. That's the difference between an organism and an eppendorf tube.

Samba
1.27.2005 11:36am
Samba Diallo (mail):
Desolé, folks, the last section [16] of the last email had already been sent. I had problems editing and forgot to cut it. But it may be worthwhile re-reading anyway.

Samba
1.27.2005 11:48am
Jeremy Parker (www):
Samba,

Is there a response to Maor's comment:

"Similarly, there was no significant difference in progression of HIV disease: 3-year progression rates to AIDS or death were 18% in both groups" [from abstract of Concorde study report in Lancet]

means that HIV carriers get AIDS without AZT just as well as with AZT."

How do you explain the progression to AIDS in the placebo group?
1.27.2005 12:11pm
Hank Barnes (mail):
Maor &Daf9,

Not bad! Good points. Will respond when I clean out a few things on my desk.

Maor:

You cited Fischl, NEJM (1987). Did you read the actual study or just the abstract?

Also, there's a companion paper to Fischl, by Richman, same issue of NEJM, called "The Toxicity of AZT........." You oughta check that out too. Those crafy folks separated the "good" stuff on AZT from the "bad" stuff in 2 separate papers. You're only citing one.

But, you get mucho points, though, for zeroing in on the right, seminal pieces.

Daf9,

You are aware that AZT was developed in 1964 (Horwitz, 1964), while Reverse Transcriptase, was not discovered until 1970 and is found in all cells, not just retroviruses, right?

"reverse transcription is a property of all cells, and is by no means confined to retroviruses" (Temin, Adv. Vir. Res.17:129-186. (1972.)

More to follow -- good discussion.

Hank Barnes
1.27.2005 12:17pm
Tom Hawkson:
Jerry Pournelle likes global warming sceptics, HIV sceptics and dislikes dishonest Ballistic Missile Defense sceptics.

Jerry has one of the best scientific minds I know. Here is his complaint:
AIDS research is yet another such field. It absorbs a LOT of public money. Is that money being allocated properly? Some people with proper credentials -- a small number, but not a vanishingly small number, and some of them are impressive -- say that the allocation of funds is skewed badly in favor of unproved hypotheses. They propose some crucial experiments to test this. The experiments wouldn't cost very much in terms of what is being spent; but in 20 years they have never been done, and the opposition to anyone questioning the prevailing theories is both heavy and serious and employs ridicule and withholding funds from people and places that were formerly well thought of. I don't have to be a biochemist to wonder if there isn't something wrong with that picture.
Is Jerry wrong? Have those experiments been done? If not, why not?

Yours,
Tom Hawkson, aka Wince

P.S. Off-Topic: If Chris the Powerblog guy is reading this, how come I can never change my account info?
1.27.2005 12:46pm
Samba Diallo (mail):
Jeremy, nobody denies the existence of AIDS. It's the causal link with HIV that's a problem. You get a guy with AIDS/ARC diagnosed, especially in the early days, because he already had something (remember that there were AIDS cases before "the test" defined by clinical criteria). He does not get AZT, he progresses, he dies. He got AZT, he progresses, he dies. HIV serostatus? Relevant or not? From the epidemiology we can agree that it is impossible to know, to much noise in the data. And IF we accept that the AZT story ain't so clear that it proves HIV causes AIDS, we have to change levels because we have left the mass media level.

The point I tried to convey with all that literature I posted and the final comment was that if the discussion has left the realm of epidemiology (HIV and AIDS graphs), then we start a whole new ball game, and one that I prefer a whole lot better (and you, from what you wrote before, do too :-). Indeed, it IS Duesberg's game, and before we go into it (I do not know how much formal training you people have) let me remind you of two things which ARE NOT meant to convince anyone a priori of anything. Just more info to have:

1) Duesberg WAS Mr. Retrovirus when Gallo came out with AIDS, that's partly why the editor of Cancer Research asked him to write the review that would eventually get him crucified in 1987. He was the guy that first mapped the physical structure of a retrovirus (LTR GAG POL ENV LTR) when that was really really hard to do. Today, any student or technician can do the same in no time and without really understanding what he/she is doing. He found 2 things: That the ones with what he called onc-genes were capable of transforming cells (cancer), and that the ones without onc-genes were ALL OVER the place (ubiquitous).

2) That was not his only contribution. My absolute favorite was before that. He discovered what would become the CLASSICAL explanantion of cyclic flu epidemics: the structure of the genome in influenza virus, which is segmented dsRNA.

THe media has presented him as a whacko came out of nowhere, but if you wonder how he managed to publish his so impopular views, it's because he was, and still is, taken much more seriously by virologists NOT working on HIV than any of his mortal opponents. So, let's take him seriously and prove he is wrong, not assume it because it's been said a zillion times, shall we?

I declare my position from the start, I think he is right. But I am willing to go through all the large amounts of literature stored in my faithful mac to recheck it in this forum.

So, let's go to it. If you people agree, maybe we could start by the 1987 Cancer Research review? HIV occupies only the very last part of it ... Then we could get to the MUCH HEAVIER PNAS 1989 review, which is my personal favorite and which addresses some points not sufficiently calrified in the 1987 one. It is also the one that got me almost kicked out of the insitute where I was studying my MSc in immunology when I thought it would be a good idea to present it in the Department seminar. Big mistake...

It's just a suggestion. What think ye?

Samba

By the way, Hank, the Richman paper you mention is alluded in the long quote above from Debating AZT.

BTW, Wince, if people agree to what I propose in this email, we will explore in detail what you quoted.
1.27.2005 12:54pm
Catch 22:
Samba:

Would you agree that the HIV/AIDS hypothesis has not been disproven on claims of self-falsification by epidemiological data presented thus far on this forum ?

Thank you for the a priori disclaimer.
1.27.2005 2:26pm
jfr (mail) (www):
Dear all,

I have for a long time reviewed the chemical et biochemical properties of AZT.

At first, you must known that glutathione deficiency is associated with impaired survival in HIV disease. : This has been demonstrated by Herzenberg &al. from the Stanford University.

They show this :

In essence, we have shown that GSH levels are lower in subjects with CD4 T cell counts below 200/µl (CD4 < 200) than in subjects at earlier stages of HIV disease; that among subjects with CD4 < 200, lower levels of GSB (a FACS measure of GSH in CD4 T cells) predict decreased survival; and that the probability of surviving 2-3 years increases dramatically as GSB level approach normal range. In addition, we have presented preliminary evidence suggesting that oral administration of NAC, which supplies the cysteine required to replenish GSH, may be associated with improved survival of subjects with very low GSH levels.



In others respects, AZT reacts quickly with thiols, in chemicaly and in biolological medium (glutathione is a thiol, and nobody can argue against the chemical rules)
In the last paper, Yamaguchi argues that :

Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization


How is it possible that a drug which create a deficiency in glutathione, can be a good treatement for a disease which is especially severe when the amounts of plasma glutathione are low?
1.27.2005 2:39pm
Shad:
Amazing how quickly the discussion fled from the defense of the sources, numbers and graphs presented in the Single Damning Demonstration to a tangent on the evils of AZT. Anyhow...

I came up with a shorter and simpler way to express the problem with the Single Damning Demonstration after watching South Park last night.

Underpants Gnomes business plan:
1. Collect underpants
2. ???
3. Profit!

Single Damning Demonstration:
1. Plot graph of HIV prevalence estimates made by the CDC using models based on the key assumption that AIDS is caused by HIV
2. ???
3. Declare that this graph shows AIDS cannot be caused by HIV!

Perhaps someone could fill in the missing step 2 for me?
1.27.2005 3:00pm
Samba Diallo (mail):
Catch 22, Shad: I agree, the detailed anlysis of the "data" on which the HIV median estimated HIV seroprevalence in the last 20 years are based does not justify ANY MEDIAN REPRESENTATION WHATSOEVER. Therefore, self-falsification has not occured. Happy? According to me you are RIGHT RIGHT RIGHT!. If you read the little jocular piece I posted so long ago, you can easily see that I thought that the definitions are so vague, and time frames so elastic, that falsification becomes impossible. I do not agree with Bialy on his claim, but I do agree with Duesberg and I think we have all demolished the predictive value of HIV seroepidemiological stats. And that is good, in my humble opinion.

Now, I did not present the graphs, but I will summarize my position on this:

1) The HIV prevalence are guestimates, and not only Bialy, based on Duesberg, chose to represent it as fairly constant. As Dean pointed out, the "we're up to one million, OMG!" stuff has been around from the very very beginning, clearly, we all agree now, not justifiably, thanks to the CDC's use of those same guestimates. The REAL numbers (exactly how many americans are HIV seropositive NOW, or in 1985) if we could know them, could just as easily disprove the AIDS graph. They could never prove it, on their own, because, all together now, "Correlation is not causation". But we do not know them, and clearly neither does the CDC, and they never did. But they sure did/do act as if they did, wouldn't you agree? Duesberg et al. published the graph as such in the peer reviewed literature because it is just as good an intepretation of the wildly fluctuating guestimates as any other you care to make, and the epidemiologist-referees agreed that the interpretation yielding a pretty flat line was reasonable, especially since Duesberg has been carefully arguing why he would not use the HIV-AIDS assumptions to interpret the data on which the guestimates are based. If you are pissed at Dr. Bialy, you should be equally pissed at the CDC, for the former showed in graphical form what the latter has been saying for two decades. Bialy does not make public health policy, the CDC does. Bialy does not scare the willies out of millions, the CDC does. Bialy is not trying to convince Africa that the even WILDER guestimates made at UNAIDS are true and Africans should spend ALL the money they have on "those safe AIDS drugs" (they sent a delegation to Mbeki's Panel, you know?). But you must recognize the the upper/lower limits of the guestimates were/are still always pretty much overlapping.

2) Duesberg et al. NEVER claimed that this PROVED anything by itself. They only pointed out that no confirmation for HIV = AIDS should be sought there, now or before, and that other data (based on REAL data - not extrapolations based on assumptions - such as number of reported OD cases or tons of coke confiscated by the police, etc) do seem to correlate better to the AIDS graph, which is based on much more solid facts than median HIV seroprevalence guestimates. Also they explain the non random distribution of AIDS mostly in men versus HIV seroprevalence roughly equally distributed in bith sexes. But not only that, he also makes a much stronger case (to me) from the biological/virological/molecular view point. Which is what I think would be worthwhile exposing to the world by way of an honest and intelligent debate. Duesberg was not given that chance, he was just vilified in the mass media, so you would know he was wrong before you knew what he was saying.

So, Catch 22, Shad, and all the rest. The last point is that, for the acceptance of the HIV = AIDS hypothesis, from the beginning, the arguments the CDC/NIH used were always epidemiological. With our newly found wisdom, what de you think of them?

Maybe we should go to the next level, where experiments can PROVE or DISPROVE apparent correlations or lack thereof?

I'll say it once more because I want to make you happy, and you honestly earned it. YOU ARE RIGHT RIGHT RIGHT!!!!!!

If Dr. Bialy insulted you, don't take it out on me. I am NOT one of his alter-personalities, although I do agree with him the HIV research is an ugly thing of dubious quality, to say the least.

Can we move on?

Samba
1.27.2005 4:17pm
daf9:
jfr writes : "How is it possible that a drug which create a deficiency in glutathione, can be a good treatement for a disease which is especially severe when the amounts of plasma glutathione are low?"

It's really quite simple.

HIV itself causes oxidative stress which as you say is bad.

AZT especially as part of a multidrug treatment kills HIV which is good.

AZT can also cause oxidative stress, which again is bad.

The question is, does AZT do more harm than good.

Check out E. J. Clin. Invest. 28, 389. It's a study of patients who've never taken antiretrovirals and shows that while NAC improves CD4+ counts it isn't nearly as good as standard antiretrovirals.

In fact there are some more recent papers suggesting that when taken with antiretrovirals, antioxidants may be helpful.
1.27.2005 5:05pm
Hank Barnes (mail):
Hi Folks,

A little more substantive response to my friend, Daf9

Okay Hank. First to clear up a misconception of how AZT works. Within the cell there are pools of deoxyribonucleotides that are required to replicate DNA.

Generally right. You could say "nucleotides" and be more clear, though. Or "base-pairs", but let's stick with nucleotides --- analogous to the "letters" that make up "words" that make up a "book."


For the cell's DNA the replication process requires an enzyme called DNA polymerase. When DNA polymerase incorporates AZT it will stop the replication process at that point.

Right. In English, this means terminating DNA synthesis, and killing the cell. Kill enough cells, you kill the body.

The enzyme required for viral replication is a different enzyme called reverse transcriptase.

Yes, although Reverse Transcriptase is found in zillions of other cells, not just retroviruses.

I quote Baltimore.“In the last few years, the view that reverse transcription is solely a retroviral mechanism has been disproven" (Baltimore, Cell. 1985 Mar;40(3):481-2. 1985)

Reverse transcriptase is killed by lower concentrations of AZT than cellular DNA polymerase is.

No, this is not correct. AZT kills much more cellular DNA because there is much more of it, than viral DNA (orders of magnitude.) In fact, HIV has about 9,000 nucleotides, while white blood cells have 3 million nucleotides.

An illustration for your perusal.

Viral DNA:

TCGACGTA

Cellluar DNA:

ACTGGGGATCTGCATGCATGCAAACCGGTTAAACGTATACATACGTA

As you know, AZT is a pyramidine nucleoside analog, which means it targets all "T" and all "C".

Clearly, there are millions of more "T" and "A" in cells, than viruses.

Important point: That's why AZT was designed as cancer chemotherapy - to target the "T" and "A" of cells gone bad through carcinogenesis . Kill the cancer cells, to save the patient. Unavoidable side-effect is that AZT kills healthy cells, too. The scientist who solves this problem, cures cancer and gets the Nobel Prize.

So, 3 points:

1. Yes, AZT will terminate DNA synthesis of the itsy-bitsy HIV genome (a good thing);

2. And, Yes, AZT will terminate DNA synthesis of the much larger cellular genome of cancer cells (another good thing);

3. But, it will also terminate DNA synthesis of healthy quick-diving cells, including the white blood cells.

That is not a good thing.

The ad hoc focus on "inhibiting" RT is purely the reddest of herrings ever devised in science in the past 50-100 years.

If I may paraphrase my political hero, James Carville -- It's the cell, stupid! (not the obscur